NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13383 Query DataSets for GPL13383
Status Public on Apr 09, 2011
Title A-UMCU-M44K-1.0
Technology type in situ oligonucleotide
Distribution non-commercial
Organism Mus musculus
Manufacturer Holstege Lab, UMC Utrecht, The Netherlands
Manufacture protocol 1. Slides are obtained from a commercial provider (Agilent) and reannotated using blat to obtain the latest gene annotations from ensembl.
Support glass
 
 
Web link http://microarrays.holstegelab.nl
Contributor(s) van Leenen D, Groot Koerkamp M, Lijnzaad P, Bakker L, Sluiters E, van Hooff S, Kemmeren P, Holstege F
Submission date Apr 08, 2011
Last update date Apr 09, 2011
Contact name Patrick Kemmeren
Organization name UMC Utrecht
Department Department of Molecular Cancer Research
Lab Holstege Lab
Street address Universiteitsweg 100
City Utrecht
State/province Utrecht
ZIP/Postal code 3584 CG
Country Netherlands
 
Samples (210) GSM707648, GSM707649, GSM707650, GSM707651, GSM707652, GSM707653 
Series (14)
GSE28587 YG001: A Usp7-Tip60 pathway regulates early adipogenesis
GSE33644 A central role for TFIID in the pluripotent transcription circuitry [PP002]
GSE33645 A central role for TFIID in the pluripotent transcription circuitry [PP003]

Data table header descriptions
ID primary identifier
METACOLUMN metagrid column position
METAROW metagrid row position
COLUMN grid column position
ROW grid row position
PROBE_ID alternative spot identifier
SUPPLIER_ID original supplier id, e.g. from agilent or operon
REPORTER_GROUP class the reporter belongs to, e.g. controls or genes
SEQUENCE nucleotide sequence
SYSTEMATIC_NAME systematic name of the gene
GENE_SYMBOL Gene symbol for the gene
ORF Gene symbol
ORGANISM organism
PRIMARY_DB primay external database identifier, format is <extdb>:<identifier>
SPOT_ID alternative spot identifier

Data table
ID METACOLUMN METAROW COLUMN ROW PROBE_ID SUPPLIER_ID REPORTER_GROUP SEQUENCE SYSTEMATIC_NAME GENE_SYMBOL ORF ORGANISM PRIMARY_DB SPOT_ID
1 1 1 1 1 QCAA003595 GE_BrightCorner qc_control CONTROL
2 1 1 2 1 QCAA003595 GE_BrightCorner qc_control CONTROL
3 1 1 3 1 QCAA000454 DarkCorner qc_control CONTROL
4 1 1 4 1 QCAA000454 DarkCorner qc_control CONTROL
5 1 1 5 1 QCAA000454 DarkCorner qc_control CONTROL
6 1 1 6 1 QCAA000454 DarkCorner qc_control CONTROL
7 1 1 7 1 QCAA000454 DarkCorner qc_control CONTROL
8 1 1 8 1 QCAA000454 DarkCorner qc_control CONTROL
9 1 1 9 1 QCAA000454 DarkCorner qc_control CONTROL
10 1 1 10 1 QCAA000454 DarkCorner qc_control CONTROL
11 1 1 11 1 QCAA000454 DarkCorner qc_control CONTROL
12 1 1 12 1 QCAA000454 DarkCorner qc_control CONTROL
13 1 1 13 1 QCAA000454 DarkCorner qc_control CONTROL
14 1 1 14 1 QCAA000454 DarkCorner qc_control CONTROL
15 1 1 15 1 QCAA000454 DarkCorner qc_control CONTROL
16 1 1 16 1 QCAA000454 DarkCorner qc_control CONTROL
17 1 1 17 1 QCAA000454 DarkCorner qc_control CONTROL
18 1 1 18 1 QCAA000454 DarkCorner qc_control CONTROL
19 1 1 19 1 QCAA000454 DarkCorner qc_control CONTROL
20 1 1 20 1 MMAB001967 A_51_P143341 gene CTCAGAAGACCAACAAAGAGCTCACTTCTCTGTGAGCGAGACAAATTAGCACCTCAAGTT ENSMUSG00000028621 Cyb5rl Cyb5rl Mus musculus ensembl:ENSMUSG00000028621

Total number of rows: 45220

Table truncated, full table size 7605 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap