U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

cox1 cytochrome c oxidase subunit 1 [ Phlebia radiata ]

Gene ID: 14469652, updated on 27-Aug-2016

Summary

Go to the top of the page Help
Gene symbol
cox1
Gene description
cytochrome c oxidase subunit 1
Locus tag
PRA_mt0001
Gene type
protein coding
RefSeq status
PROVISIONAL
Organism
Phlebia radiata (strain: 79)
Lineage
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Corticiales; Corticiaceae; Phlebia
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
Sequence:
Chromosome: MT; NC_020148.1 (1..21743)

Chromosome MT - NC_020148.1Genomic Context describing neighboring genes Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene hypothetical protein Neighboring gene large subunit ribosomal RNA

Genomic regions, transcripts, and products

Go to the top of the page Help
Genomic Sequence:
NC_020148.1

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. Mitochondrial genome of Phlebia radiata is the second largest (156 kbp) among fungi and features signs of genome flexibility and recent recombination events. Salavirta H, et al. PLoS One, 2014. PMID 24824642, Free PMC Article

GeneRIFs: Gene References Into Functions

General gene information

Go to the top of the page Help

Miscellaneous features

  • Loc: 10321-10590 LAGLIDADG_1 domain inference = alignment
  • Loc: 10684-10968 LAGLIDADG_1 domain inference = alignment
  • Loc: 1085-1189 NUMOD1 domain inference = alignment
  • Loc: 12356-12484 LAGLIDADG_2 domain inference = alignment
  • Loc: 12462-12671 LAGLIDADG_2 domain inference = alignment
  • Loc: 12682-12798 LAGLIDADG_2 domain inference = alignment
  • Loc: 12836-12937 LAGLIDADG_2 domain inference = alignment
  • Loc: 13728-14228 LAGLIDADG_2 domain inference = alignment
  • Loc: 15521-15775 GIY-YIG domain inference = alignment
  • Loc: 15806-15898 NUMOD3 (2 copies) domain inference = alignment
  • Loc: 15860-15955 NUMOD3 (2 copies) domain inference = alignment
  • Loc: 15986-16096 NUMOD1 domain inference = alignment
  • Loc: 16292-16366 NUMOD1 domain inference = alignment
  • Loc: 16709-16996 LAGLIDADG_1 domain inference = alignment
  • Loc: 17114-17386 LAGLIDADG_1 domain inference = alignment
  • Loc: 17869-18171 GIY-YIG domain inference = alignment
  • Loc: 18787-18882 NUMOD1 domain inference = alignment
  • Loc: 1971-2243 LAGLIDADG_1 domain inference = alignment
  • Loc: 20083-20370 GIY-YIG domain inference = alignment
  • Loc: 2379-2723 LAGLIDADG_1 domain inference = alignment
  • Loc: 3478-3714 LAGLIDADG_1 domain inference = alignment
  • Loc: 3814-4122 LAGLIDADG_1 domain inference = alignment
  • Loc: 5792-6103 LAGLIDADG_2 domain inference = alignment
  • Loc: 6137-6316 LAGLIDADG_2 domain inference = alignment

Repeated regions

  • Loc: 13197-13236 rpt_type = OTHER
  • Loc: 14427-14444 rpt_type = OTHER
  • Loc: 21217-21240, 21262-21285 inference = alignment , rpt_type = DISPERSED
  • Loc: 21217-21240, 21362-21385 inference = alignment , rpt_type = DISPERSED
  • Loc: 21241-21440 rpt_type = TANDEM , rpt_unit_seq = gtgtacggctgccagctttactagctgggctggcaaagcttgccggtagccgtaggttaacctagtgaacatcacggcatgtaaagctcggctggtatat(2)
  • Loc: 21257-21317, 21357-21417 inference = alignment , rpt_type = DISPERSED
  • Loc: 7828-7869 rpt_type = OTHER
  • Loc: 8067-8166, 9971-10070 inference = alignment , rpt_type = DISPERSED

General protein information

Go to the top of the page Help
Names
cytochrome c oxidase subunit 1
YP_007374857.1

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_020148.1 Reference assembly

    Range
    1..21743
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

mRNA and Protein(s)

  1. YP_007374857.1 cytochrome c oxidase subunit 1 (mitochondrion) [Phlebia radiata]

    See identical proteins and their annotated locations for YP_007374857.1

    Status: PROVISIONAL

    UniProtKB/TrEMBL
    L8B980
    Conserved Domains (2) summary
    cd01663
    Location:9 → 513
    Cyt_c_Oxidase_I; Cytochrome C oxidase subunit I. Cytochrome c oxidase (CcO), the terminal oxidase in the respiratory chains of eukaryotes and most bacteria, is a multi-chain transmembrane protein located in the inner membrane of mitochondria and the cell membrane of ...
    pfam00115
    Location:14 → 460
    COX1; Cytochrome C and Quinol oxidase polypeptide I
Nucleotide Protein
Heading Accession and Version