U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

LOC110599582 CEB1 minisatellite repeat instability region [ Homo sapiens (human) ]

Gene ID: 110599582, updated on 10-Oct-2023

Summary

Go to the top of the page Help
Gene symbol
LOC110599582
Gene description
CEB1 minisatellite repeat instability region
Gene type
biological region
Feature type(s)
misc_feature: nucleotide_motif, repeat_instability_region
misc_recomb: meiotic
repeat_region
RefSeq status
REVIEWED
Organism
Homo sapiens
Lineage
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Summary
This region is a very highly variable minisatellite region which overlaps the galactose-3-O-sulfotransferase 2 (GAL3ST2) gene on the q arm of chromosome 2. The minisatellite is an unstable GC-rich variable number tandem repeat (VNTR) with repeat units of 39 nucleotides in length that are similar, but non-identical. The consensus repeat motif, tcagcccagggacctccgcaggccaccctccctcccccc, contains the PRDM9 A binding motif (LD hotspot motif), CCNCCNTNNCCNC. A meiotic recombination hotspot that overlaps the repeat region has been found. Instability at this locus is observed in germline cells, with a strong paternal bias in the mutation rate. There is a correlation between allele length and mutation rate, with higher mutation rates in alleles with a larger number of repeats. Both intra-allelic and inter-allelic rearrangements have been observed, with intra-allelic events occurring mainly in homogeneous segments of the repeat region, and inter-allelic events displaying a slight polarity, with more rearrangements occurring at the centromere-proximal end of the minisatellite. [provided by RefSeq, Jul 2017]
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
Location:
2q37.3
Annotation release Status Assembly Chr Location
RS_2023_10 current GRCh38.p14 (GCF_000001405.40) 2 NC_000002.12 (241803954..241809030)
RS_2023_10 current T2T-CHM13v2.0 (GCF_009914755.1) 2 NC_060926.1 (242306483..242310823)

Chromosome 2 - NC_000002.12Genomic Context describing neighboring genes Neighboring gene ReSE screen-validated silencer GRCh37_chr2:242626177-242626439 Neighboring gene NANOG-H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242640872-242641704 Neighboring gene H3K4me1 hESC enhancer GRCh37_chr2:242641943-242642572 Neighboring gene inhibitor of growth family member 5 Neighboring gene ATAC-STARR-seq lymphoblastoid silent region 12557 Neighboring gene ATAC-STARR-seq lymphoblastoid silent region 12558 Neighboring gene ATAC-STARR-seq lymphoblastoid silent region 12559 Neighboring gene ATAC-STARR-seq lymphoblastoid active region 17430 Neighboring gene ATAC-STARR-seq lymphoblastoid active region 17431 Neighboring gene D-2-hydroxyglutarate dehydrogenase Neighboring gene MPRA-validated peak4107 silencer Neighboring gene H3K4me1 hESC enhancer GRCh37_chr2:242703699-242704312 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242710178-242711090 Neighboring gene H3K4me1 hESC enhancer GRCh37_chr2:242714429-242715049 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242716291-242716911 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242716912-242717532 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242717533-242718152 Neighboring gene galactose-3-O-sulfotransferase 2 Neighboring gene CDK7 strongly-dependent group 2 enhancer GRCh37_chr2:242727152-242728351 Neighboring gene uncharacterized LOC124905349 Neighboring gene neuraminidase 4 Neighboring gene H3K4me1 hESC enhancer GRCh37_chr2:242776389-242776889 Neighboring gene ReSE screen-validated silencer GRCh37_chr2:242784078-242784237 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr2:242784841-242785538 Neighboring gene uncharacterized LOC124905350

Genomic regions, transcripts, and products

Go to the top of the page Help

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. New germline mutations in the hypervariable minisatellite CEB1 in the parents of children with leukaemia. Davies BG, et al. Br J Cancer, 2007 Apr 23. PMID 17387343, Free PMC Article
  2. Meiotic recombination and flanking marker exchange at the highly unstable human minisatellite CEB1 (D2S90). Buard J, et al. Am J Hum Genet, 2000 Aug. PMID 10869237, Free PMC Article
  3. Somatic versus germline mutation processes at minisatellite CEB1 (D2S90) in humans and transgenic mice. Buard J, et al. Genomics, 2000 Apr 15. PMID 10783256
  4. Complex recombination events at the hypermutable minisatellite CEB1 (D2S90). Buard J, et al. EMBO J, 1994 Jul 1. PMID 8039512, Free PMC Article
  5. Minisatellite mutation frequency in human sperm following radiotherapy. May CA, et al. Mutat Res, 2000 Sep 20. PMID 11006413

See all (15) citations in PubMed

GeneRIFs: Gene References Into Functions

Phenotypes

Go to the top of the page Help

Review eQTL and phenotype association data in this region using PheGenI

Variation

Go to the top of the page Help

See variants in ClinVar

General gene information

Go to the top of the page Help

Other Names

  • D2S90 minisatellite repeat instability region

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

RefSeqs maintained independently of Annotated Genomes

These reference sequences exist independently of genome builds. Explain

These reference sequences are curated independently of the genome annotation cycle, so their versions may not match the RefSeq versions in the current genome build. Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, transcripts, and products above.

Genomic

  1. NG_055446.1 

    Range
    101..5177
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RefSeqs of Annotated Genomes: GCF_000001405.40-RS_2023_10

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference GRCh38.p14 Primary Assembly

Genomic

  1. NC_000002.12 Reference GRCh38.p14 Primary Assembly

    Range
    241803954..241809030
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

Reference GRCh38.p14 ALT_REF_LOCI_1

Genomic

  1. NT_187527.1 Reference GRCh38.p14 ALT_REF_LOCI_1

    Range
    16052..21128
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

Alternate T2T-CHM13v2.0

Genomic

  1. NC_060926.1 Alternate T2T-CHM13v2.0

    Range
    242306483..242310823
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)
Nucleotide Protein
Heading Accession and Version

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.

Molecular Biology Databases