U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

FRA16B fragile site, distamycin A type, rare, fra(16)(q22.1) [ Homo sapiens (human) ]

Gene ID: 109611591, updated on 10-Oct-2023

Summary

Go to the top of the page Help
Official Symbol
FRA16Bprovided by HGNC
Official Full Name
fragile site, distamycin A type, rare, fra(16)(q22.1)provided by HGNC
Primary source
HGNC:HGNC:3858
See related
MIM:136580; AllianceGenome:HGNC:3858
Gene type
biological region
Feature type(s)
misc_feature: repeat_instability_region
repeat_region
RefSeq status
REVIEWED
Organism
Homo sapiens
Lineage
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Summary
This biological region is found within an intron of the long intergenic non-protein coding RNA 922 gene on the p arm of chromosome 16. This region is a distamycin A-sensitive fragile site that contains a 33 nt AT-rich minisatellite repeat with a consensus sequence of ATATATTATATATTATATCTAATAATATATC/ATA. Fragility at this site is induced by AT base pair-specific non-intercalative DNA ligands such as distamycin A, berenil and bromodeoxyuridine. This region is highly polymorphic, with most individuals of European descent containing about 7 to 12 copies of the repeat. Expansion of the 33 nt repeat to copy numbers up to about 2000 is observed in about 5% of individuals of European descent, disrupts nucleosomal formation in the presence of distamycin A, results in delayed DNA replication at this site, forms secondary structures in vitro, and is a cause of fragility. Expanded repeats are thought to display both somatic and germline instability. [provided by RefSeq, Jan 2017]
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
See FRA16B in Genome Data Viewer
Location:
16q22.1
Annotation release Status Assembly Chr Location
RS_2023_10 current GRCh38.p14 (GCF_000001405.40) 16 NC_000016.10 (65321663..65323807)
105.20220307 previous assembly GRCh37.p13 (GCF_000001405.25) 16 NC_000016.9 (65355566..65357710)

Chromosome 16 - NC_000016.10Genomic Context describing neighboring genes Neighboring gene cadherin 11 Neighboring gene H3K27ac-H3K4me1 hESC enhancer GRCh37_chr16:65105573-65106491 Neighboring gene long intergenic non-protein coding RNA 2126 Neighboring gene NANOG hESC enhancer GRCh37_chr16:65260913-65261414 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65263556-65264056 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65264057-65264557 Neighboring gene uncharacterized LOC124903780 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65268706-65269234 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65269235-65269763 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65269764-65270292 Neighboring gene OCT4-NANOG hESC enhancer GRCh37_chr16:65340354-65341222 Neighboring gene OCT4-NANOG-H3K27ac hESC enhancer GRCh37_chr16:65352533-65353244 Neighboring gene long intergenic non-protein coding RNA 922 Neighboring gene MED14-independent group 3 enhancer GRCh37_chr16:65408883-65410082 Neighboring gene NANOG-H3K4me1 hESC enhancer GRCh37_chr16:65690017-65690516 Neighboring gene CDK7 strongly-dependent group 2 enhancer GRCh37_chr16:65691608-65692807 Neighboring gene NANOG hESC enhancer GRCh37_chr16:65747170-65747777 Neighboring gene OCT4-NANOG hESC enhancer GRCh37_chr16:65761912-65762486 Neighboring gene OCT4-NANOG hESC enhancer GRCh37_chr16:65794855-65795592 Neighboring gene H3K4me1 hESC enhancer GRCh37_chr16:65800891-65801391 Neighboring gene H3K27ac hESC enhancer GRCh37_chr16:65802715-65803215 Neighboring gene OCT4-NANOG-H3K27ac-H3K4me1 hESC enhancer GRCh37_chr16:65805808-65806404 Neighboring gene OCT4-NANOG-H3K27ac-H3K4me1 hESC enhancer GRCh37_chr16:65806405-65806999 Neighboring gene uncharacterized LOC107984823 Neighboring gene OCT4-NANOG hESC enhancer GRCh37_chr16:65850922-65851531 Neighboring gene MED14-independent group 3 enhancer GRCh37_chr16:65966974-65968173 Neighboring gene MED14-independent group 3 enhancer GRCh37_chr16:66008681-66009880 Neighboring gene H3K4me1 hESC enhancer GRCh37_chr16:66064029-66064528 Neighboring gene uncharacterized LOC105371316

Genomic regions, transcripts, and products

Go to the top of the page Help

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. Chromosome 16 abnormalities in embryos and in sperm from a male with a fragile site at 16q22.1. Martorell MR, et al. Cytogenet Genome Res, 2014. PMID 24434955
  2. Spontaneous expression of FRA16B in a non-consanguineous couple experiencing multiple fetal losses. Aswini S, et al. J Obstet Gynaecol Res, 2012 Sep. PMID 22564372
  3. DNA instability at chromosomal fragile sites in cancer. Dillon LW, et al. Curr Genomics, 2010 Aug. PMID 21286310, Free PMC Article
  4. Secondary structure formation and DNA instability at fragile site FRA16B. Burrow AA, et al. Nucleic Acids Res, 2010 May. PMID 20071743, Free PMC Article
  5. Chromatin structure of human chromosomal fragile sites. Wang YH. Cancer Lett, 2006 Jan 28. PMID 16229940

See all (38) citations in PubMed

GeneRIFs: Gene References Into Functions

Phenotypes

Go to the top of the page Help

Review eQTL and phenotype association data in this region using PheGenI

Variation

Go to the top of the page Help

See variants in ClinVar

See Variation Viewer (GRCh37.p13)

General gene information

Go to the top of the page Help

Other Names

  • FRA16B repeat instability region
  • fragile site, distamycin A type, rare, fra(16)(q22.1) repeat instability region

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

RefSeqs maintained independently of Annotated Genomes

These reference sequences exist independently of genome builds. Explain

These reference sequences are curated independently of the genome annotation cycle, so their versions may not match the RefSeq versions in the current genome build. Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, transcripts, and products above.

Genomic

  1. NG_052660.1 

    Range
    101..2245
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RefSeqs of Annotated Genomes: GCF_000001405.40-RS_2023_10

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference GRCh38.p14 Primary Assembly

Genomic

  1. NC_000016.10 Reference GRCh38.p14 Primary Assembly

    Range
    65321663..65323807
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)
Nucleotide Protein
Heading Accession and Version

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.

Molecular Biology Databases