ClinVar Genomic variation as it relates to human health
NM_001042681.2(RERE):c.4307TCCACC[3] (p.1436LH[3])
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001042681.2(RERE):c.4307TCCACC[3] (p.1436LH[3])
Variation ID: 418456 Accession: VCV000418456.6
- Type and length
-
Microsatellite, 6 bp
- Location
-
Cytogenetic: 1p36.23 1: 8358216-8358217 (GRCh38) [ NCBI UCSC ] 1: 8418276-8418277 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 27, 2017 May 6, 2023 May 7, 2021 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001042681.2:c.4307TCCACC[3] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001036146.1:p.1436LH[3] inframe insertion NM_001042681.2:c.4313_4318dupTCCACC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001042682.2:c.2645TCCACC[3] NP_001036147.1:p.882LH[3] inframe insertion NM_012102.4:c.4307TCCACC[3] NP_036234.3:p.1436LH[3] inframe insertion NC_000001.11:g.8358222AGGTGG[3] NC_000001.10:g.8418282AGGTGG[3] NG_047035.1:g.464464TCCACC[3] - Protein change
- Other names
- -
- Canonical SPDI
- NC_000001.11:8358216:GGTGGAGGTGGAGGTGG:GGTGGAGGTGGAGGTGGAGGTGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
RERE | - | - |
GRCh38 GRCh37 |
693 | 743 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Feb 28, 2018 | RCV000481955.2 | |
Pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
May 7, 2021 | RCV000578179.4 | |
Likely pathogenic (1) |
no assertion criteria provided
|
- | RCV001034582.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Sep 12, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart
Affected status: yes
Allele origin:
de novo
|
Daryl Scott Lab, Baylor College of Medicine
Accession: SCV000808920.1
First in ClinVar: Feb 03, 2018 Last updated: Feb 03, 2018 |
Number of individuals with the variant: 2
Family history: yes
|
|
Pathogenic
(Feb 28, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000565488.4
First in ClinVar: Apr 27, 2017 Last updated: Apr 17, 2019 |
Comment:
The apparently de novo c.4313_4318dupTCCACC variant in the RERE gene has been reported previously as de novo in an individual with microcephaly, developmental delay, short … (more)
The apparently de novo c.4313_4318dupTCCACC variant in the RERE gene has been reported previously as de novo in an individual with microcephaly, developmental delay, short stature, congenital heart defects, unilateral iris coloboma, choanal atresia, cryptorchidism, thin corpus callosum and ventriculomegaly (Fregeau et al., 2016). The c.4313_4318dupTCCACC variant represents the in-frame duplication of two amino acids, Leucine 1438 and Histidine 1439, denoted p.Leu1438_His1439dup. The duplicated residues are well conserved across species. The c.4313_4318dupTCCACC variant was not observed in approximately 6500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common variant in these populations. Therefore, we now interpret c.4313_4318dupTCCACC as a pathogenic variant. (less)
|
|
Pathogenic
(May 07, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart
Affected status: yes
Allele origin:
de novo
|
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Accession: SCV003922002.1
First in ClinVar: May 06, 2023 Last updated: May 06, 2023 |
Comment:
0102 - Loss of function is a known mechanism of disease in this gene and is associated with neurodevelopmental disorder with or without anomalies of … (more)
0102 - Loss of function is a known mechanism of disease in this gene and is associated with neurodevelopmental disorder with or without anomalies of the brain, eye, or heart (MIM#616975). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has high conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0600 - Variant is located in the annotated Atrophin-1 domain (PDB). (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. It has been reported as <i>de novo</i> in multiple individuals with CHARGE-like syndrome (PMIDs: 27087320, 29300383, 29330883) and as pathogenic in ClinVar. (SP) 1203 - This variant has been shown to be <i>de nov</i>o in the proband (parental status confirmed) (by trio analysis). (SP) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
|
|
Pathogenic
(Oct 27, 2017)
|
no assertion criteria provided
Method: research
|
Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart
Affected status: yes
Allele origin:
de novo
|
Sbielas Lab-Department of Human Genetics University of Michigan, University of Michigan Medical School
Accession: SCV000680056.1
First in ClinVar: Feb 03, 2018 Last updated: Feb 03, 2018 |
|
|
Likely pathogenic
(-)
|
no assertion criteria provided
Method: research
|
CHARGE syndrome
Affected status: yes
Allele origin:
de novo
|
University of Washington Center for Mendelian Genomics, University of Washington
Accession: SCV001197962.1
First in ClinVar: Apr 15, 2020 Last updated: Apr 15, 2020 |
|
|
Pathogenic
(Apr 19, 2022)
|
no assertion criteria provided
Method: literature only
|
NEURODEVELOPMENTAL DISORDER WITH ANOMALIES OF THE BRAIN AND HEART
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV002520462.1
First in ClinVar: May 27, 2022 Last updated: May 27, 2022 |
Comment on evidence:
In 2 unrelated patients, an 8-year-old girl (S7) and a boy (S8) who died at 33 days of age, Jordan et al. (2018) identified a … (more)
In 2 unrelated patients, an 8-year-old girl (S7) and a boy (S8) who died at 33 days of age, Jordan et al. (2018) identified a de novo heterozygous 6-bp duplication (c.4313_4318dupTCCACC, NM_012102.3) in the RERE gene, resulting in duplication of 2 amino acids (Leu1438_His1439dup). The duplication occurs in the atrophin-1 domain of RERE and affects a highly conserved histidine-rich region. The variant was not present in the ExAC or gnomAD databases. No functional studies were reported. Features in the female patient included truncus arteriosus, choanal atresia, chorioretinal and iris coloboma, and progressive sensorineural hearing loss. A temporal bone CT scan showed bilateral cochlear dysplasia. She also has developmental delay, intellectual disability, growth delay, and dysmorphic features. The male patient had dysmorphic features, choanal atresia, atrial septal defect, ventricular septal defect, and a mildly dilated right ventricle. Head ultrasound showed diffuse white matter changes, and brain MRI showed a simplified gyral pattern with unusually large ventricles. The features in these patients fulfilled the diagnostic criteria for CHARGE syndrome (214800), but neither patient had a pathogenic variant in the CHD7 gene (608892). Jordan et al. (2018) noted that the same 6-bp duplication had been reported in a patient with NEDBEH by Fregeau et al. (2016); this patient also met diagnostic criteria for CHARGE syndrome. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Genotype-phenotype correlations in individuals with pathogenic RERE variants. | Jordan VK | Human mutation | 2018 | PMID: 29330883 |
Genetic analysis of CHARGE syndrome identifies overlapping molecular biology. | Moccia A | Genetics in medicine : official journal of the American College of Medical Genetics | 2018 | PMID: 29300383 |
De Novo Mutations of RERE Cause a Genetic Syndrome with Features that Overlap Those Associated with Proximal 1p36 Deletions. | Fregeau B | American journal of human genetics | 2016 | PMID: 27087320 |
Text-mined citations for rs1064793252 ...
HelpRecord last updated May 07, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.