U.S. flag

An official website of the United States government

NM_007194.4(CHEK2):c.87_107dup (p.Ser31_Gly37dup) AND Familial cancer of breast

Germline classification:
Uncertain significance (2 submissions)
Last evaluated:
Mar 24, 2024
Review status:
2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001858289.9

Allele description [Variation Report for NM_007194.4(CHEK2):c.87_107dup (p.Ser31_Gly37dup)]

NM_007194.4(CHEK2):c.87_107dup (p.Ser31_Gly37dup)

Gene:
CHEK2:checkpoint kinase 2 [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
22q12.1
Genomic location:
Preferred name:
NM_007194.4(CHEK2):c.87_107dup (p.Ser31_Gly37dup)
HGVS:
  • NC_000022.11:g.28734623_28734643dup
  • NG_008150.2:g.12232_12252dup
  • NM_001005735.2:c.87_107dup
  • NM_001257387.2:c.-691_-671dup
  • NM_001349956.2:c.87_107dup
  • NM_007194.4:c.87_107dupMANE SELECT
  • NM_145862.2:c.87_107dup
  • NP_001005735.1:p.Ser31_Gly37dup
  • NP_001336885.1:p.Ser31_Gly37dup
  • NP_009125.1:p.Ser31_Gly37dup
  • NP_665861.1:p.Ser31_Gly37dup
  • LRG_302t1:c.87_107dup
  • LRG_302:g.12232_12252dup
  • LRG_302p1:p.Ser31_Gly37dup
  • NC_000022.10:g.29130602_29130603insTGGGACTGTGAGGAGGAGCCT
  • NC_000022.10:g.29130611_29130631dup
  • NG_008150.1:g.12200_12220dup
  • NM_007194.3:c.87_107dupAGGCTCCTCCTCACAGTCCCA
Links:
dbSNP: rs762863407
NCBI 1000 Genomes Browser:
rs762863407
Molecular consequence:
  • NM_001257387.2:c.-691_-671dup - 5 prime UTR variant - [Sequence Ontology: SO:0001623]
  • NM_001005735.2:c.87_107dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001349956.2:c.87_107dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_007194.4:c.87_107dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_145862.2:c.87_107dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Name:
Familial cancer of breast
Synonyms:
Breast cancer, familial; Hereditary breast cancer
Identifiers:
MONDO: MONDO:0016419; MedGen: C0346153; OMIM: 114480

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV002226960Labcorp Genetics (formerly Invitae), Labcorp
criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))
Uncertain significance
(Dec 4, 2022)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

SCV004217669Baylor Genetics
criteria provided, single submitter

(ACMG Guidelines, 2015)
Uncertain significance
(Mar 24, 2024)
unknownclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing
not providedunknownunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240. doi: 10.1038/s41436-019-0624-9.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]
PMID:
25741868
PMCID:
PMC4544753

Details of each submission

From Labcorp Genetics (formerly Invitae), Labcorp, SCV002226960.3

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 483400). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. This variant is present in population databases (rs762863407, gnomAD 0.006%). This variant, c.87_107dup, results in the insertion of 7 amino acid(s) of the CHEK2 protein (p.Ser31_Gly37dup), but otherwise preserves the integrity of the reading frame.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Baylor Genetics, SCV004217669.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024