Over three million Americans are infected by the Hepatits C Virus (HCV) virus 2 which is particularly lethal for Acquired Immunodeficiency Syndrome (AIDS) patients, of whom increasing numbers are co-infected with Human Immunodeficiency Virus infection (HIV) and HCV. There is no vaccine, and the only available treatment, based on a combination of interferon and ribavirin, cures less than half of the patients. One of the important structural proteins of HCV is the core protein. HCV core has many reported functions in the host cells, but its main purpose for the virus is to enclose and thereby protect the HCV Ribonucleic acid (RNA) genome during disease transmission. The conserved nature of HCV and absence of a vaccine, along with studies demonstrating that core contributes to host cell oncogenesis, apoptosis inhibition, and suppression of host T cell responses, support a role for core as a major pathogenic component of HCV. As a result, the identification of specific inhibitors of HCV core dimerization may provide tools for inhibiting HCV assembly without host cell effects. Several studies identify HCV capsid assembly as an appropriate target for chemotherapeutic intervention of HCV infections. Thus, this High Throughput Screen (HTS) program was initiated to identify small molecules that inhibit HCV core protein dimerization. Following an HTS effort and several rounds of medicinal chemistry, we have identified compound CID 49800087 as inhibitor probe (ML322) belonging to the [1,2,4]triazolo[1,5-a]pyrimidin-2-yl scaffold. The probe inhibits dimerization of core proteins in biochemical Alphascreen assays (IC50 = 8.4 μM; 51% inhibition at 15 μM). Using quantitative polymerase chain reactions (QPCR) the probe was shown to reduce levels of total HCV RNA in infected cells (IC50 = 1.8 μM) and significantly reduces levels of infectious HCV RNA in cells treated with HCV-containing culture supernatants (IC50 = 2 nM). Profiling revealed that probe ML322 lacks activity against a panel of 63 receptors, transporters, and ion channels (Ricerca). Modest activity was detected at muscarinic M1-3, adrenergic alpha, and dopamine transporter (DAT). Critically, probe ML322 is not cytotoxic against the Huh7.5 liver cell line used for the infectivity assays (CC50 = 33 μM). This novel probe represents an exciting tool for use in basic HCV research to elucidate the mechanisms by which core-core dimerization contributes to HCV nucleocapsid formation, HCV infection, and liver cancers associated with HCV.

Probe Structure & Characteristics

Probe ML322

1. Introduction

The Hepatitis C virus (HCV) is a major cause of liver failure and hepatocellular cancer, with about 170 million people infected worldwide [1]. In the United States over three million individuals are infected with the HCV virus 2, which is particularly lethal for AIDS patients, of whom increasing numbers are co-infected with HIV and HCV3 [2]. There is currently no vaccine available [3, 4], and the only available treatment, based on a combination of pegylated interferon and ribavirin, cures less than half of the patients.

The HCV has a small RNA genome that is directly translated by the infected host cell into a single precursor polyprotein that is processed by enzymatic cleavage into 10 proteins of diverse function. The most N-terminal 21kDa protein of this HCV polyprotein is the HCV core (C) protein, which is a highly basic, RNA-binding structural protein essential for assembly and packaging of the viral genome [5]. Core protein is cleaved by a host peptidase and anchored to the host cell endoplasmic reticulum, where it undergoes further processing into its mature form [6]. The N terminal portion of this mature C protein mediates viral assembly through homodimerization and formation of higher order complexes with viral RNA to form the nucleocapsid, while the hydrophobic C terminal interacts with envelope glycoproteins to form the infectious particle [7].

Several drugs are under clinical investigation (Phase 2 or 3) as anti-viral therapy for HCV. These include inhibitors of NS5B polymerase, NS3/NS4A protease, and NS5A [3]. However, potent, low nanomolar inhibitors of HCV infection based on the inhibition of core protein dimerization are unavailable. Thus, any small molecule probe identified will serve as an important step in the development of lead compounds for novel HCV therapies. The novel probe reported here, ML322, exhibits an IC₅₀ of 1.8 μM (T2 QPCR) for blocking the levels of total HCV RNA in cells. In addition the probe potently reduces the levels of infections HCV RNA in cells (TCID₅₀ = 2 nM). All sets of biochemical and cellular assay data were highly reproducible between batches and runs. Importantly, ML322 also consistently lacks activity in the cytotoxicity counterscreen (CC₅₀ >30 μM), demonstrating that it does not significantly affect liver cell viability. Probe ML322 lacks significant inhibitory activity effects against the majority of therapeutic targets tested (Ricerca screening). Together these results demonstrate that probe ML322 far surpasses the probe criteria set forth in the chemical probe development plan.

2. Materials and Methods

All chemical reagents and solvents were acquired from commercial vendors. All assay protocols are reported in the relevant PubChem AIDs, provided in Table 1. Solubility, stability, and glutathione reactivity analyses were conducted in accordance with NIH guidelines. CYP450 inhibition and microsome stability analyses were performed as previously described [8].

Table 1

HCV Core Inhibitors Project (see also Summary AID 1911).

2.1. Assays

Table 1 lists all PubChem AIDs for the HCV Core Inhibitor project. Descriptions of the assays follow the table.

Primary Assay

2.1a. HCV Core Primary Assays (see AID 1899 (1X%INH), AID 2152 (3X %INH), AID 2159(IC50), and AID 2488 (powders, assay provider’s lab)

The purpose of this biochemical assay is to determine the ability of test compounds to prevent dimerization of the hydrophilic N-terminal domain (residues 1–106; core106) of the HCV core protein (9). In this assay, test compounds are incubated with N-terminally tagged GST-core106 and Flag-core106 peptides, followed by addition of a Europium cryptate-tagged anti-GST antibody and a XL-665-tagged anti-Flag antibody. Dimerization of the core106 peptides and subsequent antibody binding brings the antibody tags into close proximity, allowing FRET from the Europium donor to the XL-665 acceptor, resulting in an increase in well FRET. As designed, compounds that inhibit core106 dimerization will prevent the interaction of the tagged antibodies, blocking the transfer of energy from Europium to XL-665, and thus inhibiting well FRET. Test compounds were assayed in singlicate (AID 1899) and triplicate (AID 2152) at a final nominal concentration of 5 micromolar, in quadruplicate in a 10-point 1:3 dilution series starting at a nominal test concentration of 50 micromolar (Round 0: AID 2159, Round 1: AID 2488).

Prior to the start of the assay, 5 microliters of Assay Buffer (100 mM HEPES, 0.5 mM EDTA, 2.5 mM DTT, 200 mM Potassium Fluoride, 0.05% CHAPS, 0.05% BSA, pH 7.45, filtered at 0.22 micrometer) were dispensed into columns 1 and 2 of 1536-well assay plates. The remaining 46 columns were filled with 2 microliters of Assay Buffer supplemented with 225 ng/mL of Eu(K)-anti GST antibody and 42.5 nM of Flag-Core106. Next, 1 microliter of inhibition controls were dispensed into column 3 (12.5 micromolar unlabeled core106 protein, 100% inhibition), column 46 (200 nM core106 protein, 50% inhibition), and columns 4 to 45, 47 and 48 (Assay Buffer alone). Twenty-five nL of 10-points serial dilutions of test compounds or DMSO alone (0.5% final concentration) were then added to the appropriate wells. Next, 2 microliters of Assay Buffer supplemented with 2.5 micrograms/mL XL665-anti FLAG antibody and 33.75 nM GST-Core106 were dispensed to columns 3 to 48. The assay plates were centrifuged for 30 seconds at 300g and incubated for 4 hours at 22.5 degrees Celsius. At the end of the incubation time, TR-FRET was measured by exciting the plates at 340nm, and monitoring well fluorescence at 617 nm (Eu) and 671 nm (XL665) with the ViewLux microplate reader (PerkinElmer). All wells had a final volume of 5 microliters. The final reagent concentrations were 90 ng/mL Eu(K)-anti GST antibody, 1 microgram/mL XL665-anti FLAG, 17 nM Flag-Core106 and 13.5 nM GST-Core106. Final concentrations of competing, untagged Core 106 proteins were 2.5 micromolar and 40 nM for the 100% and 50% inhibition controls, respectively.

Secondary Assays

2.1b. Alphascreen Assays (see AID 463085, AID 651576, and AID 651577)

The purpose of this biochemical assay is to determine whether powder samples of compounds identified as possible HCV core probe candidates can disrupt the dimerization of HCV Core molecules (9). This assay employs the AlphaScreen technology, a secondary Amplified Luminescent Proximity Homogeneous Assay. This assay was run by the assay provider. Compounds were tested in duplicate at 15 micromolar (AID 651576) and in triplicate in a 10-point series starting at a nominal test concentration of 50 micromolar (AID 463085 and AID 651577).

Figure 1Alphascreen Technology

AlphaScreen is based on the use of photoactive donor and acceptor beads that recognize specific tags on interacting proteins (10). Core106 dimerization was confirmed using AlphaScreen technology in which a core106 protein domain was tagged with either Glutathione-S-transferase (GST) tag or a Flag peptide tag. The untagged core106 protein domain was used as a model competitor in the assay. The proteins were diluted to working concentrations in ‘protein buffer’ (100 mM HEPES pH 7.5, 1 mM EDTA, 5 mM DTT, 0.1% CHAPS, 10% glycerol). The donor and acceptor beads were diluted to working concentrations in ‘bead buffer’ (20 mM HEPES pH7.5, 125 mM NaCl, 0.1% BSA, 0.1% CHAPS). GST-tagged core106 (150 nM) was incubated with 150 nM of Flag-tagged core106 for 1 hour at room temperature. Anti-Flag acceptor beads were added to the proteins at a final concentration of 20 μg/ml and incubated for 1 hour at room temperature. Then Glutathione donor beads were added to the proteins at a final concentration of 20 μg/ml and incubated for 1 hour. The assays were executed in a white 384 well Packard optiplate and were read on Perkin Elmer Envision.

2.1c. Cytotoxicity Assays (see AID 485280 and AID 651583)

The purpose of this assay is to determine whether powder samples of compounds identified as possible HCV core probe candidates are cytotoxic to Huh-7.5 cells. The assay utilizes compound XTT (2,3-bis[2-Methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxyanilide inner salt) with addition of an electron coupling agent phenazine methosulfate (PMS) to measure mitochondrial dehydrogenases activity in living cells. Dehydrogenases in mitochondria of living cells will cleave the tetrazolium ring of XTT changing the color of the solution from clear to orange. As designed, compounds that reduce cell viability will reduce activity of the mitochondrial dehydrogenases, thereby reducing the orange color in solution and well absorbance. Compounds were tested in triplicate in a 7-point 1:3 dilution series starting at a nominal test concentration of 320 μM (AID 485280 and AID 651583).

The Huh-7.5 cell line was routinely cultured in 15-cm dishes at 37 C and 95% relative humidity (RH). The growth media consisted of DMEM supplemented with 10% v/v certified fetal bovine serum, 4 mM L-glutamine, 1 mM sodium pyruvate, 1X antibiotic mix (penicillin, streptomycin, and glutamine), and 1X non-essential amino acids.

Prior to the start of the assay 8000 cells in 100 μL volume of colorless growth media were dispensed into each well of 96-well tissue culture-treated microtiter plates and incubated overnight at 37 C (5% CO2, 95% RH) to allow cells to adhere to the plate. The next day, 100 μL of test compound in DMSO (1.25 % final DMSO concentration) and DMSO only were added to wells. Wells with only test compound in media without cells were used to normalize the data (to account for the color a test compound may have). Next, the plates were incubated for 72 hours at 37 C (5% CO2, 95% RH). Solution of XTT-PMS was prepared in 1X PBS and added to the cells in 50 μL volume to each well and incubated for 4 hours at 37 C (5% CO2, 95% RH). After equilibrating the plates to room temperature for 10 minutes, optical density at 450 nm and 650 nm was measured on Biotek plate reader.

2.1d. Follow-up Assays to determine Selectivity and Cell-based Efficacy

Additional assays were outsourced to Ricerca or were performed by the assay provider in order to elucidate the selectivity and cell-based efficacy of the probe candidates. These assays are explained in subsequent sections of this report. See Sections 3.5 & 3.6 for details.

2.2. Probe Chemical Characterization

The chemical structure of the probe was verified by analysis of its 400 MHz 1H NMR spectra obtained on a Brüker 400 MHz instrument; data are summarized in Section 2.3 (Probe Preparation). The chemical structure was also corroborated by its LC/MS molecular ion (calc form/z (M+1): 416.2454.4 and (m/z (M+Na)): 476.3, using an Agilent 1200/6140 multimode quadrupole rapid resolve system) as well as its expected fragmentation patterns. Purity was measured at >95% (LC/MS analysis, confirmed by analytical HLPC analysis). HPLC data was obtained using an Agilent 1200 analytical HPLC with an Agilent Eclipse XDB-C18 column, 2.1×50mm. The HPLC solvents used were acetonitrile and water (gradient 0–100% acetonitrile in 5 min) with 0.1% formic acid added to each mobile phase as the pH modifier. The retention time found was 1.23 min.

As shown in Table 2, the solubility of probe ML322 in PBS at pH 7.4 was determined to be ≥100 μM. Solubility was ≥100 μM in conditions reflective of a cell-based assay environment (DMEM, 10% FBS). Importantly, its solubility is fully adequate to provide the high potency seen in cell-based infectivity assays (0.1–10 μM) and is also adequate for broad use as a biological probe to be used in a variety of aqueous-based media.

Table 2

Probe Properties.

The probe has a half-life of >48 hours in PBS at room temperature when tested at 10 μM. Disappearance of the LC peak for the ML322 is not altered by addition of excess glutathione, indicating that ML322 is not thiol-reactive under physiologically-relevant conditions.

ML322 is stable in DMSO solution at room temperature (no erosion of peak intensity after 7 days) and is also stable as a free base dry powder.

Table 3 lists the samples and quantities of probe ML322 and analogs submitted to the MLSMR.

Table 3

Probe and Analogs submitted to the MLSMR.

2.3. Probe Preparation (SR-1966; ML322)

Figure 2Synthesis of probe ML322

Synthesis of diketone 3[9, 10]

To a solution of 2,4-pentadione 1 (1.0 g, 10 mmol) in acetone (10 mL) were successively added potassium carbonate (1.38 g, 10 mmol) and 4-methylbenzyl bromide 2 (1.85 g, 10 mmol). The mixture was stirred overnight at reflux and was quenched with water (10 mL). The aqueous phase was extracted with AcOEt and the combined organic phases were washed with brine, dried over Na₂SO₄, filtered and concentrated under reduced pressure. Purification of the crude product by flash chromatography on silica gel (hexanes/AcOEt: 4/1) afforded the known^1,2 diketone 3 (1.82 g, 89%). ¹H NMR (300 MHz, CDCl₃) δ 16.81–16.83 (br. s, 0.5H), 6.97–7.15 (m, 4H), 3.99 (t, 0.5H, J= 7.3 Hz), 3.61 (s, 1H), 3.10 (d, 1H, J= 7.3 Hz), 2.30–2.32 (s, 3H), 2.12 (s, 3H), 2.06 (s, 3H).

Synthesis of ester 6 [11]

To a solution of NaOH (880 mg, 22 mmol) in water (50 mL) was added the commercially available 5-amino-3-mercapto-1,2,4-triazole (4) (2.32 g, 20 mmol). The mixture was stirred for 15 min at room temperature, then a solution of ethyl bromoacetate (3.34g, 20 mmol) in MeOH (5 mL) was added. The mixture was stirred for 2 h at room temperature. The solid in suspension was filtered and recrystallized from EtOH providing the known³ ester 6 (2.0 g, 50%). ¹H NMR (400 MHz, DMSO-d₆) δ 11.87 (s, 1H), 6.04 (s, 2H), 4.05 (q, J = 7.2 Hz, 2H), 3.82 (s, 2H), 1.15 (t, J = 7.2 Hz, 3H).

Synthesis of ester 7

To a solution of ester 6 (202 mg, 1 mmol) in acetic acid (5 mL) was added diketone 3 (204 mg, 1 mmol). The reaction was heated at 100°C for 24 h, then was concentrated under reduced pressure. Purification of the crude product by flash chromatography on silica gel (hexanes/AcOEt : 1/1) afforded ester 7 (160 mg, 43%). ¹H (400 MHz, CDCl₃) δ 7.10 (d, J = 8.0 Hz, 2H), 6.89 (d, J = 8.0 Hz, 2H), 4.23 (q, J = 7.2 Hz, 2H), 4.12 (s, 2H), 4.07 (s, 2H), 2.73 (s, 3H), 2.55 (s, 3H), 2.32 (s, 3H), 1.29 (t, J = 7.2 Hz, 3H).

Synthesis of carboxylic acid 8

To a 3N solution of NaOH (2 mL, 6 mmol) in THF (2 mL) was added ester 7 (160 mg, 0.43 mmol). The reaction mixture was stirred 5 h at room temperature, then was diluted with water (5 mL). The aqueous phase was extracted with EtOAc, then was acidified until pH 5 and was extracted twice with EtOAc. The combined organic phases were washed with brine, dried over Na₂SO₄, filtered and concentrated under reduced pressure to give acid 8 (143 mg, 97%). ¹H (400 MHz, CDCl₃) δ 7.11 (d, J = 8.0 Hz, 2H), 6.89 (d, J = 8.0 Hz, 2H), 4.11 (s, 2H), 3.89 (s, 2H), 2.78 (s, 3H), 2.60 (s, 3H), 2.32 (s, 3H).

Synthesis of amide 10

To a solution of acid 8 (50 mg, 0.15 mmol) and triethylamine (0.1 mL, 0.75 mmol) in CH₂Cl₂ (1 mL) were successively added the hydrochloride salt of EDC (43 mg, 0.22 mmol), HOBt (30 mg, 0.22 mmol), and commercially available amine 9 (103 mg, 0.45 mmol). The reaction mixture was stirred at room temperature for 24 h and was directly subjected to column chromatography on silica gel (CH₂Cl₂/MeOH: 9/1). This provided amide 10 (75 mg, 90%). ¹H (400 MHz, CDCl₃) δ 7.69 (broad s, 1H), 7.11 (d, J = 8.0 Hz, 2H), 6.89 (d, J = 8.0 Hz, 2H ), 4.08 (s, 2H), 3.91 (s, 2H), 3.35 (q, J = 5.8 Hz, 2H), 3.27 (m, 4H), 2.75 (s, 3H), 2.56 (s, 3H), 2.44 (t, J = 6.3 Hz, 2H), 2.34-2.27 (m, 7H), 1.43 (s, 9H).

Synthesis of SR-1966 (Probe ML322)

To a solution of amide 10 (75 mg, 0.13 mmol) in CH₂Cl₂ (3 mL) was added trifluoroacetic acid (0.5 mL). The reaction mixture was stirred overnight at room temperature, then was concentrated under reduced pressure. Purification of the crude product by flash column chromatography using a Biotage SNAP cartridge KP-NH (CH₂Cl₂/MeOH : 9/1) afforded SR-1966 (56 mg, 95%). ¹H (400 MHz, CDCl₃) δ 7.59 (t, J = 5.1 Hz, 1H), 7.1 (d, J = 8.1 Hz, 2H), 6.9 (d, J = 8.1 Hz, 2H), 4.09 (broad s, 2H), 3.93 (broad s, 2H), 3.35 (q, J = 5.9 Hz, 2H), 2.76 (s, 3H), 2.69 (dd, J = 4.49, 5.25 Hz, 4H), 2.58 (s, 3H), 2.42 (t, J = 6.2 Hz, 2H), 2.34-2.28 (m, 7H); ¹³C (100 MHz, CDCl₃) δ 168.8, 166.0, 164.8, 153.7, 144.6, 136.6, 133.8, 129.5 (2C), 127.3 (2C), 119.6, 56.8, 52.9 (2C), 45.2 (2C), 36.3, 34.4, 32.9, 24.0, 20.9, 14.2; IR (neat) 3293, 2943, 2816, 1663, 1613, 1511, 1377, 1367, 1341, 1295, 1158 cm⁻¹. MS (ES−) m/z = 452 (found for C₂₃H₃₁N₇OS-H⁺).

3. Results

The flow chart (Figure 3) outlines the results of the uHTS screening campaign for HCV Core dimerization inhibitors at the SRIMSC. Following primary HTS in singlicate to identify HCV Core dimerization inhibitors using a TR-FRET-based assay (AID 1899), available MLSMR compounds were selected for confirmation testing in triplicate (AID 2152). Available compounds that confirmed activity and were deemed not to be fluorescent artifacts were tested in dose response assays in triplicate (AID 2159). Of the 128 compounds ordered, 24 were removed as being artifact, and 12 were not available from the MLSMR. The dose response identified 92 compounds as possible quenchers or fluorescent artifiacts. As a result the top 9 available non-optically active compounds were ordered for testing as powders for confirmation of activity.

Figure 3

HCV Core dimerization HTS campaign overview.

The compounds with the highest potency in the HTS HCV Core FRET-based dose response assay (AID 2159) are shown in Table 4.

Table 4

Most potent scaffolds from the HTS campaign.

Following cheminformatic analyses of the 92 compounds tested in HCV core titration HTS assays, fluorescence quenchers and fluorescent artifacts (non-optically active) were removed, resulting in 9 compounds with promising activity. Two compounds did not recapitulate activity.

Compounds identified as clean hits included SID 49716510 (CID 22422906/ SR-01000819396), SID 56317368 (CID 24979772), SID 56323176 (CID 9426403), SID 47193664 (CID 5280489), SID 56316484 (CID 24979394) (see Figure 6). Powder samples of 9 promising compounds were ordered by the SRIMSC and tested in the same FRET-based biochemical HCV core dimerization assay to confirm activity (Table 5, AID 2488). Only CID 22422906 was active (IC₅₀ = 3.66 μM), and its potency was similar to that of the earlier (liquid) batch provided by the MLSMR (IC₅₀ = 9.86 μM, AID 2159).

Figure 6

Structures of prior art compounds SL201 and SL209.

Table 5

The top Round 0 analog results.

Samples of SID 56317368 and SID 56323176 that were synthesized in our laboratory had activity far less than the HTS and were not pursued further. SID 56316484 (CID 24979394) was not pursued owing to the weak activity from HTS (IC₅₀ = 48 μM), plus the presence of a labile ester bond was a concern. SID 47193664 (CID 5280489) was not pursued owing to the lack of a clear path for SAR. Finally, SID 855627 (CID 1780) was identified as a “frequent hitter” active in numerous PubChem assays and was removed from further consideration.

Based on recapitulation of CID 22422906, this compound and purchased analogs were submitted to the assay provider for testing in Alphascreen assays at 15 micromolar and liver cell cytotoxicity assays. As shown in the first row of Table 5, only CID 22422906 met the criteria of a probe candidate: non-toxic to Huh 7.5 liver cells (AID 485280, CC₅₀ = 123 μM), active in a secondary amplified luminescent proximity homogeneous assay (Alphascreen AID 463085, IC₅₀ = 5 μM), and able to inhibit the levels of HCV RNA in infected cells treated with viral culture supernatants (QPCR assay, AID 485271). CID 22422906 is active in only 15 of 288 PubChem Bioassays tested (5.2%); however, several of the assays are fluorescence- or FRET-based. As a result, further SAR was pursued. This compound belongs to the 1,2,4]triazolo[1,5-a]pyrimidin-2-yl scaffold.

Medicinal Chemistry to explore SAR of CID 22422906

Due to the promising activity and lack of liver cell cytotoxicity of CID 22422906, the SRISMC purchased and synthesized additional analogs to explore the SAR. These analogs were submitted to the Strosberg lab for testing using an orthogonal Alphascreen-based biochemical assay at 15 micromolar and to determine potency (Table 6).

Table 6

Round 1 Analogs: Alphascreen results. SL274 was ultimately claimed as probe ML322.

3.1. Summary of Screening Results

The HTS campaign identified a number of potential probe precursors (HTS Figure 3). The series of efforts used to determine probe candidates and ultimately the probe ML322 is summarized in the hit to probe optimization flow chart (Figure 5). Data from primary, confirmatory and concentration response for the HCV Core screen were subjected to cheminformatics analysis to determine what scaffolds have near-neighbor active and inactive analogs, indicating the potential for SAR.

Figure 5

Probe development overview (post-HTS).

The most promising hits in HCV Core active scaffolds were then validated by assay data obtained using independent batches of test samples, purchased or synthesized in-house. Certain hits gave variable assay results upon re-supply. Others validated upon re-supply, with HCV Core IC₅₀ values within 2-fold of the HTS value. These were the hits of highest interest that progressed to SAR studies. Compounds were further prioritized as candidates for probe development based upon the SAR of purchased or synthesized analogs, based also upon the finding that certain compounds gave only low levels of HCV Core dimerization inhibition relative to other compounds (Figure 5).

As discussed in Section 3, only CID 22422906 survived as a viable starting point for probe development. To explore this series, the Strosberg lab pursued additional counterscreening and cell-based efficacy testing (Table 7). Also included in Table 7 are comparative data for two compounds, SL201 and SL209 (Figure 6), derived from prior work by the assay provider on the development of small molecule inhibitors of the hepatitis C virus by inhibition of Core dimerization [12]. As shown by these comparative data, SL201 and SL209 are far less effective at inhibiting production of infectious HCV particles (IC₅₀ = 0.286 μM for SL209) than the probe compound (SID 103771539; SR-1966, SL274) that has IC₅₀ = 2 nM in this assay.

Table 7

Secondary assay results (Strosberg lab). SL274 was the most potent in cell-based HCV infectivity assays and was selected to be probe ML322.

3.2. Dose Response Curves for Probe

As shown in Table 7, ML322 has robust on-target activity in biochemical and cell-based target assays. The probe is not cytotoxic to Huh7.5 liver cells, and is able to block HCV production in these same cells. The dose response curves for the probe in the HCV biochemical and cell-based assays are shown (Figure 7).

Figure 7

Dose response curves for Probe ML322 in the Alphascreen (A), QPCR T1/T2 (B), and TCID50 assays (C).

3.3. Scaffold/Moiety Chemical Liabilities

As discussed in the original Chemical Probe Development Plan (CPDP) for this project, hits were prioritized based on their SAR profile determined from HTS, follow-up assays and results of SAR by purchase. The potency, selectivity and chemical tractability of the hit series summarized in Sections 3.0 and 3.1 were considered. Hits or scaffold series that possess potential chemical instability or toxicological problems were eliminated (e.g., SID 47193664 and SID 855627), as clear strategies could not be devised to address these issues for these two hits. The chemical series selected for optimization (e.g., SID 49716510) has the potential to address lesions associated with existing probes, to meet the criteria for a successful probe as laid out in the CPDP, and to improve the state of the art in the field.

Synthetic tractability, chemical stability, stability in biological systems, drug-likeness [13, 14], lead likeness [15], lack of structural alerts [16] and anticipated physical properties such as solubility are considered in the selection of hits for probe development.

The post-HTS analysis led to the identification of six compounds as the top hits (Figure 4). Of these, all but SID 49716510 were eliminated from further consideration owing to the limited opportunities for SAR expansion or the weakness of the original hit (see reasons summarized in red for each structure in Figure 4). SID855627 has also been eliminated from further consideration owing to its promiscuous nature in PubChem assays, and concerns about the chemical/biochemical stability of the polyacetylene unit.

Figure 4

Selection of SID 49716510 as the starting point for SAR hit optimization.

SID 49716510 was confirmed using a powder sample purchased from a commercial source. One round of SAR by purchase was performed (9 analogs were available), and several of the compounds were as active as, if not more active as SID 49716510. Based on these results, the first round of analog synthesis was completed, and an additional ca. 20 SID 49716510 analogs were provided to the Strosberg lab. After HCV core dimerization inhibition data with those new analogs, a decision was made to resource the project for additional analog synthesis. Subsequent testing of synthesized analogs by the Strosberg lab revealed that CID 49800087 was the most promising probe candidate (Figure 8).

Figure 8

Comparison of the structures of the original HTS lead and final Probe ML322.

Because several individual compounds within this [1,2,4]triazolo[1,5-a]pyrimidin-2-yl inhibitor series showed the biochemical and cell-based potency and lack of cytotoxicity necessary to be high quality probes (Table 7), we subjected samples of the top compounds to CYP450 analysis (Table 8) and microsomal stability (Table 9) to aid in probe selection. The results of these studies revealed that probe ML322 does not significantly inhibit cytochrome P450 enzymes. The probe is highly stable to liver microsomes in mouse and human, with a measured half-life of 40 min and 27 min, respectively.

Table 8

Probe ML322 is not a strong inhibitor of cytochrome P450 enzymes.

Table 9

Hepatic Microsome Stability of Selected HCV Core Inhibitors.

Results in Tables 7–9 show that several compounds were generally suitable as probes. We chose CID 49800087 (SR-1966 or SL274) as the probe (designated ML322) due to its superior activity in inhibiting formation of infectious HCV particles (Table 7), its lack of significant inhibition of human CYPs, and the presence of a basic amine to aid solubility and ease of formulation. ML322 has no serious structural liabilities. Minor issues are the relatively poor stability of ML322 analogs CID 22422908 and CID 9550395 in mouse microsomes.

The probe contains a [1,2,4]triazolo[1,5-a]pyrimidin-2-yl scaffold (Figure 7). It contains one amide bond which may pose a liability to protease degradation and a thioether that is potentially prone to metabolic oxidation or reduction. The probe and analogs do not react with glutathione and are chemically stable so long as they are not used in highly acidic media (pH<2). The relative ease of synthesis of the probe molecule and analogs by the described method is a strong asset for this scaffold series and this probe. Scale-up synthesis, if needed for extensive long-term biological studies, will be highly feasible.

3.4. SAR Tables

SAR Table 1Lead scaffolds from the HTS campaign

View in own window

SR Number	SID	CID	Vendor	Structure	AID 2488 HTRF IC50 (uM)	Outcome	AID 463085 Alphascreen IC50 (uM)	Outcome	AID 485271 HCV QPCR T1 IC50 (uM)	T2 IC50 (uM)	Outcome	AID 485280 Cytox CC50	Outcome
SR-01000819396-2	87219211	22422906	ChemDiv		3.666	Active	5.0	Active	6.6	12	Active	123	Inactive
SR-01000763803-4	87219208	5280489	Sigma Chemical		>49.751	Inactive	34.8	Inactive	Not tested due to lack of Alphascreen activity			171.9	Inactive
SR-01000839920-2	87219213	24979772	Enamine		20.49	Inactive	29.8	Inactive				140.7	Inactive
SR-01000000036-3	87219207	1780	Sigma Chemical		>49.751	Inactive	Not tested due to lack of HTRF activity		Not tested due to lack of HTRF activity			178.6	Inactive
SR-01000812654-2	87219209	694792	ChemBridge		>49.751	Inactive	Not tested due to lack of HTRF activity		Not tested due to lack of HTRF activity			142.9	Inactive
SR-01000812946-2	87219210	1557339	Pharmeks		46.17	Inactive						24.7	Inactive
SR-01000839796-2	87219212	24981182	Enamine		>49.751	Inactive						27.4	Inactive
SR-01000840236-2	87219214	24979394	Enamine		40.43	Inactive						148.4	Inactive
SR-01000849831-2	87219215	9426403	Enamine		21.17	Inactive						163.3	Inactive

SAR Table 2Probe and lead analogs

View in own window

SR Number	SID	CID	Vendor	Structure	AID 651576 %INH at 15 μM	%INH Outcome	IC50 Core Dimerization (μM)	IC50 Outcome	Assay OUTCOME	AID 651574 T1 IC50 (μM)	Outcome	T2 IC50 (μM)	Outcome	Overall Outcome	AID 624575 TCID50 (uM)	Outcome	AID 624583 Cytox	Outcome
SR-03000001966-1	103771539	49800087	SRIMSC-synth		51	Active	8.4	Active	Active: PROBE ML322	IC50 not determined at this timepoint		1.8	Active	Active (PROBE ML322)	0.002	Active (PROBE ML322)	33.79	Inactive (Probe ML322)
SR-03000001539-3	99309211	22422908	SRIMSC-synth		82	Active	1.9	Active	Active	8.5	Active	13.7	Active	Active	0.191	Active	42.6	Inactive
SR-01000668805-2	103771538	9550395	SRIMSC-synth		60	Active	1.0	Active	Active	11.96	Active	Not tested due to probe’s lower TCID50 value		Active	0.312	Active	> 12	Inactive
SR-03000002010-1	104179723	49849980	SRIMSC-synth		66	Active	3.0	Active	Active	0.099	Active			Active	0.032	Active	180.4	Inactive
SR-03000002013-1	104179726	49849987	SRIMSC-synth		87	Active	1.3	Active	Active	Not tested due to probe’s lower cytotoxicity							> 4	Inactive
SR-03000002015-1	104179728	49849986	SRIMSC-synth		65	Active	5.7	Active	Active	3.067	Active	Not tested due to probe’s lower TCID50 value		Active	0.294	Active	> 36	Inactive
SR-03000002037-1	104223097	49852628	SRIMSC-synth		79	Active	2.6	Active	Active	2.7	Active	7.2	Active	Active	0.004	Active	13.83	Active
SR-03000002053-1	104233653	49859551	SRIMSC-synth		62.4	Active	10.2	Active	Active	5.3	Active	12.5	Active	Active	Not tested due to probe’s lower TCID50 value		37.64	Inactive

SAR Table 3Analogs

View in own window

SR Number	SID	CID	Vendor	Structure	AID 651576 %INH of Core dimerization at 15 μM	Outcome	IC50 Core Dimerization (μM)	Outcome (Active, Inactive, or Not Tested)	OVERALL OUTCOME	AID 651574 T1 IC50 (μM)	Outcome	T2 IC50 (μM)	Outcome	Overall Outcome	AID 624575 TCID50 (uM)	Outcome	AID 624583 Cytox	Outcome
SR-03000002229-1	123050594	52914829	SRIMSC-synth		85%	Active	9.9	Active	Active	7.7	Active	T2 result not determined		Active	0.286	Active	22.11	Active
SR-03000002054-1	104233654	49859550	SRIMSC-synth		53%	Active	5.1	Active	Active	18.9	Active	24.3	Inactive	Inactive	1.241	Active	193.2	Inactive
SR-03000002055-1	104233655	49859547	SRIMSC-synth		83%	Active	1.6	Active	Active	3.2	Active	2.2	Active	Active	0.665	Active	9.51	Active
SR-03000001539-1	96022352	22422908	ChemNavigator		97%	Active	1.9	Active	Active	8.5	Active	13.7	Active	Active	Not tested due to probe’s lower TCID50 value
SR-01000819396-3	96022357	22422906	ChemNavigator		16%	Inactive	Low %INH value so IC50 not pursued		Inactive	6.7	Active	12	Active	Active
SR-03000001523-1	96022334	22422894	ChemNavigator		59%	Active			Active	Not tested due to probe’s lower TCID50 value
SR-01000550123-2	96022348	4060916	ChemNavigator		40%	Inactive			Inactive
SR-03000002051-1	104233651	49859548	SRIMSC-synth		< 50%	Inactive			Inactive

SR Number	SID	CID	Vendor	Structure	AID 651576 %INH of Core dimerization at 15 μM	Outcome	IC50 Core Dimerization (μM)	Outcome (Active, Inactive, or Not Tested)
SR-03000002052-1	104233652	49859549	SRIMSC-synth		< 50%	Inactive	Not tested because Probe ML322 found to be more potent.
SR-03000001537-1	96022349	15997098	ChemNavigator		71%	Active
SR-01000550140-2	96022350	4144944	ChemNavigator		30%	Inactive
SR-03000001538-1	96022351	15998711	ChemNavigator		38%	Inactive
SR-01000550124-2	96022354	4060917	ChemNavigator		22%	Inactive
SR-01000550112-2	96022355	4060781	ChemNavigator		52%	Active
SR-03000001540-1	96022356	22422895	ChemNavigator		65%	Active
SR-03000001541-1	96022358	6621239	ChemNavigator		33%	Inactive
SR-03000001542-1	96022359	15987932	ChemNavigator		43%	Inactive
SR-03000001581-1	96099796	46238463	SRIMSC-synth		52%	Active
SR-03000001587-1	97302163	46245561	SRIMSC-synth		87%	Active
SR-03000001588-1	99205837	46829287	SRIMSC-synth		88%	Active
SR-03000001650-1	99233657	46846222	SRIMSC-synth		96%	Active
SR-03000001651-1	99233658	46846224	SRIMSC-synth		88%	Active
SR-03000001652-1	99233659	46846226	SRIMSC-synth		78%	Active
SR-03000001653-1	99233660	46846218	SRIMSC-synth		80%	Active
SR-03000001654-1	99233661	46846216	SRIMSC-synth		67%	Active
SR-03000001655-1	99233662	46846225	SRIMSC-synth		85%	Active
SR-03000001656-1	99233663	46846228	SRIMSC-synth		89%	Active
SR-03000001657-1	99233664	46846219	SRIMSC-synth		90%	Active
SR-03000001658-1	99233665	46846231	SRIMSC-synth		92%	Active
SR-03000001659-1	99233666	46846217	SRIMSC-synth		98%	Active
SR-03000001660-1	99233667	46846232	SRIMSC-synth		89%	Active
SR-03000001661-1	99233668	46846221	SRIMSC-synth		80%	Active
SR-03000001668-1	99233670	46846220	SRIMSC-synth		93%	Active
SR-03000001692-1	99239457	46850834	SRIMSC-synth		67%	Active
SR-03000001693-1	99239458	46850820	SRIMSC-synth		80%	Active
SR-03000001963-1	103771536	49800086	SRIMSC-synth		< 50%	Inactive
SR-03000001964-1	103771537	49800089	SRIMSC-synth		< 50%	Inactive
SR-03000001982-1	103947204	49837841	SRIMSC-synth		< 50%	Inactive
SR-03000001983-1	103947205	49837838	SRIMSC-synth		< 50%	Inactive
SR-03000002009-1	104179722	49849981	SRIMSC-synth		< 50%	Inactive
SR-03000002011-1	104179724	49849983	SRIMSC-synth		66%	Active	52	Inactive
SR-03000002012-1	104179725	49849979	SRIMSC-synth		< 50%	Inactive	Not tested because Probe ML322 found to be more potent.
SR-03000002014-1	104179727	49849975	SRIMSC-synth		< 50%	Inactive
SR-03000002029-1	104223089	49852629	SRIMSC-synth		< 50%	Inactive
SR-03000002029-1	104223089	49852629	SRIMSC-synth		<50%	Inactive
SR-03000002030-1	104223090	49852642	SRIMSC-synth		< 50%	Inactive
SR-03000002030-1	104223090	49852642	SRIMSC-synth		<50%	Inactive
SR-03000002031-1	104223091	49852630	SRIMSC-synth		<50%	Inactive
SR-03000002031-1	104223091	49852630	SRIMSC-synth		< 50%	Inactive
SR-03000002032-1	104223092	49852633	SRIMSC-synth		< 50%	Inactive
SR-03000002033-1	104223093	49852646	SRIMSC-synth		< 50%	Inactive
SR-03000002034-1	104223094	49852637	SRIMSC-synth		< 50%	Inactive
SR-03000002035-1	104223095	49852649	SRIMSC-synth		<50%	Inactive
SR-03000002036-1	104223096	49852644	SRIMSC-synth		<50%	Inactive
SR-03000002128-1	114279612	50930769	SRIMSC-synth		<50%	Inactive
SR-03000002169-1	116933614	50985833	SRIMSC-synth		<50%	Inactive
SR-03000002186-1	117695952	51035445	SRIMSC-synth		−11%	Inactive
SR-03000002228-1	123050593	52914830	SRIMSC-synth		44%	Inactive
SR-03000002230-1	123050595	52914838	SRIMSC-synth		46%	Inactive
SR-03000002231-1	123050596	52914841	SRIMSC-synth		87%	Inactive
SR-03000002232-1	123050597	52914840	SRIMSC-synth		41%	Inactive
SR-01000120796-2	123050598	22422913	SRIMSC-synth		13%	Inactive
SR-03000002233-1	123050599	52914831	SRIMSC-synth		37%	Inactive
SR-03000002234-1	123050600	52914835	SRIMSC-synth		63%	Active
SR-03000002252-1	123054981	52918352	SRIMSC-synth		79%,	Active
SR-03000002253-1	123054982	52918345	SRIMSC-synth		11%	Inactive
SR-03000002256-1	123054984	52918341	SRIMSC-synth		51%	Active
SR-03000002294-1	124338630	53230259	SRIMSC-synth		42%	Inactive
SR-03000002295-1	124338631	53230283	SRIMSC-synth		25%	Inactive
SR-03000002340-1	124349346	53239851	SRIMSC-synth		12%	Inactive
SR-03000002341-1	124349347	53239825	SRIMSC-synth		10%	Inactive
SR-03000002342-1	124349348	53239847	SRIMSC-synth		44%	Inactive
SR-03000002343-1	124349349	53239839	SRIMSC-synth		43%	Inactive
SR-03000002344-1	124349350	53239842	SRIMSC-synth		14%	Inactive
SR-03000002345-1	124349351	53239843	SRIMSC-synth		41%	Inactive
SR-03000001965-1	135649607	56946976	SRIMSC-synth		51%	Active	29	Inactive

3.5. Cellular Activity

HCV Infectivity Assays

The next set of assays performed were biological assays used to determine the ability of compounds to inhibit production of J6/JFH1, 2a strain virus in Huh-7.5 liver cells (Figure 9). HCV infectivity is measured using real-time RT-PCR to monitor changes in expression of HCV 2a J6/JFH-1 RNA. Cells are incubated with test compound in the presence of HCV, followed by isolation of RNA, conversion to cDNA, and Taqman-based QPCR. As designed, a compound that inhibits HCV infectivity will reduce HCV RNA expression, leading to decreased production of the PCR amplicon, thereby reducing fluorescence, and increasing Ct. Compounds were tested in triplicate using a 6-point 1:10 dilution series starting at a nominal test concentration of 100 μM. Note that the TCID₅₀ values (AID 624575) are significantly lower than the T1/T2 QPCR values (AID 485271 Rounds 0–1; AID 651574 (Round 2). These assays have been previously described [12, 17].

Figure 9

HCV Infectivity assay method.

Cells were plated the day before the assay. After allowing the cells to adhere overnight, test compound was prepared in HCV supernatant by making 1:10 serial dilutions from 100 μM down to 0.001 μM. Doses of test compound in virus were added to cells and incubated for 24 hours. The next day, cell culture media was removed from each well and replaced with the same dilutions of compound in complete media. This was added to cells and incubated for another 48 hours for the T1 timepoint. Next, the cells were lysed and RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA). Supernatant from T1 (early stage infection) was transferred to naive cell cultures and incubated for 24 hours. After 24 hours the culture medium was removed from the cells and replaced with complete media and the cells were incubated for 48 hours for the T2 (late stage) timepoint. Cells for the T2 timepoint were lysed and RNA was isolated as was done for the T1 timepoint. cDNA was generated using the Taqman reverse transcription kit (Applied Biosystems, Foster City, CA). Quantitative real-time polymerase chain reaction (QPCR) was performed in triplicate using the LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM-TATGAGTGTCGTGCAGCCTC-MGBNFQ on a model LightCycler480 real time PCR system (Roche). Data are expressed as the mean fold change in mRNA levels, plus or minus the SE of 3 replicates normalized to 100 μg total RNA. Primers used were forward CTTCACGCAGAAAGCGTCTA and reverse CAAGCACCCTATCAGGCAGT. The range of activity was normalized based on measurement of total RNA. Compounds with an IC50 value greater than 20 μM were considered inactive. Compounds with an IC₅₀ value equal to or less than 20 μM were considered active. All compounds tested were active in this assay. However, one compound (SR-03000001966-1/ SID 103771539/ CID 49800087) exhibited significantly greater potency than all others compounds tested: TCID50 = 2 nM. As a result this compound was claimed as the probe ML322 (Table 10, next page).

Table 10

TCID₅₀ Results (see AID 624575).

4. Discussion

Core is a structural protein of the HCV virion and is essential for viral assembly and infectious virus production. ML322 is a potent and selective inhibitor of the core protein-protein dimerization. The probe has an IC₅₀ of 8.4 μM in the absorbance-based biochemical Amplified Luminescent Proximity Homogeneous Assay (Alphascreen), indicating it can block the interaction between HCV core proteins. Because core-core dimerization is thought to be important for mediating viral assembly and formation of the viral nucleocapsid cell-based infectivity assays were performed to determine whether the probe could block infectivity using a cell culture system. The probe exhibits an IC₅₀ of 1.8 μM (T2 QPCR) for blocking the levels of total HCV RNA in cells. In addition the probe potently reduces the levels of infections HCV RNA in cells (TCID₅₀ = 2 nM). The significantly lower IC₅₀ value in the TCID₅₀ assay, relative to the T2 QPCR assay, reflects the fact that one needs to interfere with only a few of the potential core-core protein interactions to prevent formation an infectious HCV particle (TCID₅₀ assay), whereas the T2 QPCR data reflects the concentration required to inhibit one-half of all possible core-core dimer interactions in the in vivo experiment. All sets of biochemical and cellular assay data were highly reproducible between batches and runs. Importantly, ML322 also consistently lacks activity in the hepatocyte cytotoxicity counterscreen (CC₅₀ >30 μM), demonstrating that it does not significantly affect liver cell viability. Probe ML322 lacks significant inhibitory activity effects against the majority of therapeutic targets tested (Ricerca screening). Together these results demonstrate that probe ML322 far surpasses the probe criteria set forth in the chemical probe development plan.

It must be noted that protein-protein interactions are notoriously difficult to efficiently and selectivity disrupt using small molecule ligands and that micromolar activity for disrupting a protein-protein interaction using a rule-of-five compliant small molecule is noteworthy. In fact, certain clinically useful anticancer compounds acting by disrupting protein-protein interactions are less potent against their targeted proteins [18]. The finding that probe ML322 is not cytotoxic to liver cells (Huh7.5) indicates that the probe may be particularly useful to researchers in testing the hypothesis that targeting interactions of core proteins can thwart mechanisms used by HCV to avoid inhibition by other immune enhancing drugs such as pegylated interferon or ribavirin, treatments currently in use for hepatitis with significant off-target effects.

The probe lacks general reactivity (is nonreactive with glutathione), is not a significant inhibitor of major CYP450 isoforms, and is readily synthesized in high purity without chromatography in a single chemical step. Probe ML322 also has chemical stability, with useful levels of water solubility (>100 μM in PBS, >100 μM in simulated assay conditions). Moreover, the probe has favorable properties associated with drug-likeness, with a moderate molecular weight (454), acceptable parameters for LogP (2.76), tPSA (84.7), and lack of groups associated with inherent toxicity. Due to these chemical and biological properties, ML322 should prove useful in in vitro and perhaps in in vivo studies aimed at understanding how HCV core dimerization regulates HCV packaging, host cell oncogenesis, and suppression of host T cell responses.

4.1. Comparison to existing art and how the new probe is an improvement

At the onset of the HTS campaign no published prior art small molecules were known to selectively disrupt the dimerization of HCV core. However, during the HTS and chemistry effort that led to discovery of ML322, the assay provider in collaboration with Boston University discovered several molecules with activity in the HCV Core dimerization Alphascreen and cell-based infectivity assays (Table 7). While these compounds represent exciting and promising scaffolds, none exhibits the cell-based potency as high as that of ML322 (TCID50 = 2nM). Additional studies are needed to elucidate the specific mechanisms by which these compounds inhibit core dimerization. However, 4 of the 5 compounds in Table 12 (ML322 included) do not exhibit liver cell toxicity, suggesting their action is targeted to the viral core protein.

Table 12

Comparison of the prior art with HCV Core probe ML322.

5. References

1.

Hoofnagle JH. Course and outcome of hepatitis C. Hepatology. 2002;36(5 Suppl 1):s21–s29. [PubMed: 12407573]

2.

Soriano V, et al. Challenges and opportunities for hepatitis C drug development in HIV-hepatitis C virus-co-infected patients. AIDS. 2011;25(18):2197–208. [PubMed: 21866039]

3.

Dore GJ. The changing therapeutic landscape for hepatitis C. Med J Aust. 2012;196(10):629–32. [PubMed: 22676877]

4.

Hoofnagle JH. Course and outcome of hepatitis C. hepatology. 2002;36(5 Suppl 1):S21–9. [PubMed: 12407573]

5.

Lin C, et al. Processing in the hepatitis C virus E2-NS2 region: identification of p7 and two distinct E2-specific products with different C termini. J Virol. 1994;68(8):5063–73. [PMC free article: PMC236449] [PubMed: 7518529]

6.

Moradpour D, Blum HE. A primer on the molecular virology of hepatitis C. Liver Int. 2004;24(6):519–25. [PubMed: 15566499]

7.

Majeau N, et al. The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation. J Gen Virol. 2004;85(Pt 4):971–81. [PubMed: 15039539]

8.

Brothers SP, et al. Selective and brain penetrant neuropeptide y y2 receptor antagonists discovered by whole-cell high-throughput screening. Mol Pharmacol. 2010;77(1):46–57. [PMC free article: PMC2802430] [PubMed: 19837904]

9.

Terent’ev AO, et al. Facile and selective procedure for the synthesis of bridged 1,2,4,5-tetraoxanes; strong acids as cosolvents and catalysts for addition of hydrogen peroxide to beta-diketones. J Org Chem. 2009;74(9):3335–40. [PubMed: 19298073]

10.

Sakai T, et al. One-Pot C-Arylmethylation of Active Methylene Compounds with Aromatic Aldehydes Induced by a Me3SiCl–NaI–MeCN Reagent. Bull. Chem. Soc. Jpn. 1989;62(12):4072–4074.

11.

Chen Q, et al. Synthesis, antifungal activity and CoMFA analysis of novel 1,2,4-triazolo[1,5-a]pyrimidine derivatives. Eur J Med Chem. 2008;43(3):595–603. [PubMed: 17618711]

12.

Wei W, et al. New small molecule inhibitors of hepatitis C virus. Bioorg Med Chem Lett. 2009;19(24):6926–30. [PMC free article: PMC2783740] [PubMed: 19896376]

13.

Lipinski CA, et al. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Deliv Rev. 2001;46(1–3):3–26. [PubMed: 11259830]

14.

Walters WP. Going further than Lipinski's rule in drug design. Expert Opin Drug Discov. 2012;7(2):99–107. [PubMed: 22468912]

15.

Rishton GM. Nonleadlikeness and leadlikeness in biochemical screening. Drug Discov Today. 2003;8(2):86–96. [PubMed: 12565011]

16.

Benigni R, Bossa C. Mechanisms of chemical carcinogenicity and mutagenicity: a review with implications for predictive toxicology. Chem Rev. 2011;111(4):2507–36. [PubMed: 21265518]

17.

Kota S, et al. A time-resolved fluorescence-resonance energy transfer assay for identifying inhibitors of hepatitis C virus core dimerization. Assay Drug Dev Technol. 2010;8(1):96–105. [PMC free article: PMC2971647] [PubMed: 20035614]

18.

Verdine GL, Walensky LD. The challenge of drugging undruggable targets in cancer: lessons learned from targeting BCL-2 family members. Clin Cancer Res. 2007;13(24):7264–70. [PubMed: 18094406]