Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a (http://xgc.nci.nih.gov/) Xenopus Gene Collection library.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on