BioSample

RNA obtained from human embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early neural progenitor cell type. Cell line id and NIH Registry designation is BGO1. Positive for Nestin and Musashi expression. Passage number 18. cDNA primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. This primary library is non-normalized (normalized primary library is NIH_MGC_259). It was constructed by Express Genomics (Frederick, MD). Sequence ends have been trimmed to exclude vector and regions below Phred quality 16. Note: this is a Mammalian Gene Collection library.