Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
This library was made from dT primed cDNA and cloned into Invitrogen pCMVsport6 vector. The work was done at DOE Joint Genome Institute. Poly A RNA were primed with 5' GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT 3'. CDNA were ligated to SalI adapter (5' TCGACCCACGCGTCCG and 5'CGGACGCGTGGG), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into NotI and SalI digested pCMVsport6 vector.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on