BioSample

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_279) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.