Human primary human ocular pericytes. Unamplified ... - BioSample

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Organism: Homo sapiens (human)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Primates; Haplorrhini; Simiiformes; Catarrhini; Hominoidea; Hominidae; Homininae; Homo

Attributes

Description: RNA was extracted from primary human pericytes in culture. A directionally cloned cDNA library in the pSPORT1 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed at the NIH Intramural Sequencing Center (NISC).