Root cDNA. The mRNA was isolated from entire roots of 8 day old 'Williams' seedlings which were propagated on paper towels with distilled water. Stratagene's cDNA Synthesis Kit (catalog #200401) was used to synthesize the cDNA. First- strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA is hemimethylated. Stratagene's first-strand synthesis primer was used [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)-18]. After second-strand synthesis, the cDNA ends were 'polished' with clone Pfu DNA polymerase, ligated to EcoRI adapters, and phosphorylated. The XhoI site within the first-strand synthesis primer was restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript II XR Predigested vector (pBluescript II SK(+) that had been digested with EcoRI and XhoI, and phosphorylated). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts. Blue colonies 9n=15) have been sequenced, and possess putative cDNA inserts. This library was constructed by Dr. Paul Keim & Virginia H. Coryell, Department of Biology, Box5640, Northern Arizona University, Flagstaff, AZ 86011, Phone: 520-523-1078 (Dr. Paul Keim), 520-523-1372 (Virginia H. Coryell), Fax: 520-523-7500, email: paul.keim@nau.edu, virginia.coryell@nau.edu