NICHD_XGC_Te2N

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Organism: Xenopus laevis (African clawed frog)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus

Attributes

tissue	Pooled samples from 6 adult male testis
lab host	DH10B TonA
tissue	testis
vector	pExpress-1
v_type	plasmid
re_1	EcoRV
re_2	NotI

Description: RNA obtained from 6 adult male testis. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is an NIH_XGC library