Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on