Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Two human lenses from different adults (both approximately 40 years old) together yielded 20ug of total RNA and 150ng mRNA for cDNA library synthesis. A directionally cloned cDNA library in the pCMVSPORT6 vector was constructed at Life Technologies, essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. Not I/blunt end inserts were cloned into the Not I/EcoR V sites in the vector. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on