NICHD_XGC_bone - BioSample - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Links from Nucleotide

NICHD_XGC_bone

Identifiers: BioSample: SAMN00150672; EST: LIBEST_020093

Organism: Xenopus laevis (African clawed frog)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus

Attributes

tissue	limb bones (zeugopods and stylopods), pooled from 3 individuals
lab host	DH10B TonA
tissue	bone
vector	pCS111
v_type	plasmid
re_1	SmaI
re_2	NotI

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.65 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a (http://xgc.nci.nih.gov/) Xenopus Gene Collection library.

Submission: National Cancer Institute / NIH, Daniela S. Gerhard, Ph.D.; 2006-08-04

Accession:: SAMN00150672
ID:: 150672

Supplemental Content

Related information

Nucleotide
Nucleotide links

Recent activity

Clear Turn Off Turn On

BioSample links for Nucleotide (Select 111597621) (1)
BioSample
NICHD_XGC_bone
NICHD_XGC_bone

biosample
Taxonomy Links for Nucleotide (Select 126264166) (1)
Taxonomy
Cd200r1l CD200 receptor 1 like [Mus musculus]
Cd200r1l CD200 receptor 1 like [Mus musculus]
Gene ID:319823

Gene
319823[uid] AND (alive[prop]) (1)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > DNA & RNA > BioSample