Uncultured bacteria isolated from gingival sulcus ... - BioSample

host sex	female
host	Tursiops truncatus
collection date	2010-02-10
tissue	Oral
host age	29.5 years
geographic location	USA: San Diego Bay, CA
isolation source	swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z
host body habitat	Gingival sulcus (mouth)
broad-scale environmental context	Marine environment
local-scale environmental context	Marine mammal
environmental medium	Swab sample of the gingival sulcus
latitude and longitude	32.6717 N 117.1441 W
host subject id	DolZOral124
host taxonomy ID	9739 (9739)
miscellaneous parameter	Lactating
barcode_sequence	AGAGTAGCTAAG
linker_primer	GCACTCCTACGGGAGGCAGCA
454_run	EB1

Supplemental Content

Uncultured bacteria isolated from gingival sulcus of 29 year old lactating femal...
Uncultured bacteria isolated from gingival sulcus of 29 year old lactating female Dolphin_Z

biosample
Uncultured bacteria isolated from gingival sulcus of 5 year old male Dolphin_J
Uncultured bacteria isolated from gingival sulcus of 5 year old male Dolphin_J

biosample
MAG: Acidovorax sp. 35-64-16, whole genome shotgun sequencing project
MAG: Acidovorax sp. 35-64-16, whole genome shotgun sequencing project
gi|1232590351|gb|NCFM00000000.1|NCF 0000

Nucleotide
MAG: Rhodobacterales bacterium 32-66-7, whole genome shotgun sequencing project
MAG: Rhodobacterales bacterium 32-66-7, whole genome shotgun sequencing project
gi|1232475113|gb|NCDS00000000.1|NCD 0000

Nucleotide
MAG: Thiotrichales bacterium 17-46-47, whole genome shotgun sequencing project
MAG: Thiotrichales bacterium 17-46-47, whole genome shotgun sequencing project
gi|1232802251|gb|NCIN00000000.1|NCI 0000

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.