BUxVI-1

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Organism: Veronica incana
cellular organisms; Eukaryota; Viridiplantae; Streptophyta; Streptophytina; Embryophyta; Tracheophyta; Euphyllophyta; Spermatophyta; Magnoliopsida; Mesangiospermae; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Lamiales; Plantaginaceae; Veroniceae; Veronica; Veronica subgen. Pseudolysimachium

Attributes

collection date	2012-08-18
broad-scale environmental context	temperate natural grassland
local-scale environmental context	steppe
environmental medium	plant roots
geographic location	Mongolia
investigation type	mimarks-survey
project name	Continental
sample name	611-BUxVI-1
ENA first public	2015-08-05
ENA last update	2016-10-21
ENA-CHECKLIST	ERC000020
External Id	SAMEA3750328
INSDC center alias	UT-IEES
INSDC center name	Institute of Ecology and Earth Sciences, University of Tartu, Estonia
INSDC first public	2015-08-05T17:01:45Z
INSDC last update	2016-10-21T09:41:48Z
INSDC status	public
Submitter Id	611-BUxVI-1
adapters	TACG
geographic location (elevation)	1630
geographic location (latitude)	47.7578
geographic location (longitude)	107.1322
geographic location (region and locality)	Bogd Uul
multiplex identifiers	AGTGTCTG
pcr primers	TTGGAGGGCAAGTCTGGTGCC
plant-associated environmental package	plant-associated
sequencing method	454 GS FLX Titanium