Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’; 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
| Accession | PRJEB21368 |
| Scope | Monoisolate |
| Publications | Cui J et al., "Coupling metagenomics with cultivation to select host-specific probiotic micro-organisms for subtropical aquaculture.", J Appl Microbiol, 2017 Nov;123(5):1274-1285 |
| Submission | Registration date: 22-Aug-2017
BGI-SHENZHEN |
Project Data:
| Resource Name | Number
of Links |
|---|
| Sequence data |
| SRA Experiments | 94 |
| Publications |
| PubMed | 1 |
| Other datasets |
| BioSample | 94 |