Microbial community structure diversity was analyzed by 16S rRNA sequencing, five activated sludge and biofilm samples were collected from two reactors, respectively, they were named R1 (inoculated sludge), R2 (oxic phosphorus removal sludge, 56 days), R3 (biofilm, 56 days), R4 (denitrifying phosphorus removal sludge, 136 days), R5 (biofilm, 136 days).
More...Microbial community structure diversity was analyzed by 16S rRNA sequencing, five activated sludge and biofilm samples were collected from two reactors, respectively, they were named R1 (inoculated sludge), R2 (oxic phosphorus removal sludge, 56 days), R3 (biofilm, 56 days), R4 (denitrifying phosphorus removal sludge, 136 days), R5 (biofilm, 136 days). Sequencing was performed using IIlumina MiSeq platform and (Shanghai Meiji Technology Co., LTD.), and microbial community structure diversity was analyzed using Mothur (v.1.31.2) and QIIME (vl.8.0) software.The PCR amplified primer name was 338F_806R, the F-terminal sequence was ACTCCTACGGGAGGCAGCAG, and the R-terminal sequence was GGACTACHVGGGTWTCTAAT.
Less...