The sampling campaign took place during the Antarctic expedition November 2021- February 2022. In this campaign, 14 selected localities have been visited in the northern Victoria Land, within the south latitudinal range from the 72 to 77 parallel (Table 1). At least three individuals of each selected lichen species, when present and feasible to collect, were sampled in each locality. The samples were aseptically removed with the rock substrate using a geological hammer, placed into sterile plastic bags, and stored dry at -20 C, also during the transportation to the laboratories, until downstream analyses.The following lichen species were collected and used for the molecular analyses: the endemic Antarctic Acarospora flavocordia, Buellia frigida, Lecanora fuscobrunnea, Lecanora physciella, Lecidea cancriformis, and the cosmopolitan Pleopsidium chlorophanum, Rhizoplaca melanophthalma, Rusavskia elegans. Along the study they will be referred to by their abbreviated name as follow: A. flavocordia, B. frigida, L. fuscobrunnea, L. physciella, L. cancriformis, P. chlorophanum, R. melanophthalma and R. elegans.DNA extraction, amplification and sequencing of fungal and bacterial communities
For the amplicon sequencing analyses, three thalli of each species were selected from each location at which the lichen species was collected. Metagenomic DNA extraction was performed on a 0.5 cm2 fragment of the thallus, devoid of any symptoms of external infection or damage, which was removed from the substrate using a sterile razor blade, and transferred into 1.5 ml reaction tubes. The fragments underwent a series of washes: they were rinsed three times for 15 min with sterile water, followed by a 30 min cleaning step using a 2% Tween 80 solution. A final wash was performed for 15 min with sterile water. The DNA extraction from the cleaned fragments followed the CTAB protocol of Cubero et al. (1999), with minor adjustments. Potential contaminants during the DNA extraction process were checked by establishing negative control samples for each lichen species. These negative controls consisted of a 1.5 ml tube kept open during the whole extraction process, and processed in the same way as the lichen samples for the amplification and sequencing steps.
To study the diversity of fungal communities, the nuclear ribosomal internal transcribed spacer 1 region (ITS1) was targeted. The ITS1 region was amplified using the barcoded primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC; White et al., 1990; Smith and Peay, 2014). The PCR amplification protocol for the ITS1 fragments was run with the following condition: an initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 94 C for 45 sec, annealing at 55 C for 45 sec, extension at 72 C for 1 min, and a final extension step at 72 C for 5 min.
The V4 variable region of the small ribosomal subunit 16S rDNA was used to assess bacterial diversity. This variable region was amplified using the primers F515 (GTGCCAGCMGCCGCGGTAA) and R806 (GGACTACHVGGGTWTCTAAT) as described by Caporaso et al. (2012). The PCR amplification of the V4 variable region was performed with the following protocol: an initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 94 C for 45 sec, annealing at 50 C for 1 min, extension at 72 C for 90 sec, and a final extension step at 72 C for 10 mins.
Samples were then sequenced in pair ends (2x300 bp) using the Illumina MiSeq platform at the Edmund Mach Foundation (San Michele all'Adige, Italy). Less...