ITS-2 metabarcoding of Cyathostominae: mock communityM3 - SRA

SRX15393996: ITS-2 metabarcoding of Cyathostominae: mock communityM3
1 ILLUMINA (Illumina MiSeq) run: 45,115 spots, 20.6M bases, 12.9Mb downloads

Design: ITS-2 gene region was PCR amplified using the NC1 and NC2 primers, added of one to three random bases to the 5' primer end, a 2bp linker and 28 bp Illumina adapter overhang. Single multiplexing was performed using a homemade 6 bp index, which was added to reverse primer during a second PCR with 12 cycles using forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC) and reverse primer (CAAGCAGAAGACGGCATACGAGAT-index-GTGACTGGAGTTCAGACGTGT).

Submitted by: INRAE

Study: Effect of sainfoin (Onobrychis viciifolia) on cyathostomin communities

PRJNA840924 • SRP376320 • All experiments • All runs

show Abstracthide Abstract

The project aimed to test for cyathostomin differential abundances between horses fed with sainfoin or a control diet using an ITS-2 based metabarcoding approach.

Sample:

SAMN28568547 • SRS13121095 • All experiments • All runs

Organism: Cyathostominae

Library:

Name: ITSM3_GGATCA-JRDRM_L001

Instrument: Illumina MiSeq

Strategy: AMPLICON

Source: GENOMIC

Selection: PCR

Layout: PAIRED

Runs: 1 run, 45,115 spots, 20.6M bases, 12.9Mb

Run	# of Spots	# of Bases	Size	Published
SRR19334727	45,115	20.6M	12.9Mb	2022-06-15

ID:: 21934705

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Recent activity