In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 927819). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant occurs in a non-coding region of the MSH6 gene. It does not change the encoded amino acid sequence of the MSH6 protein.
ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.4079_*9dup (p.Leu1360_Ter1361=)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(2)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Conflicting classifications of pathogenicity
Uncertain significance(1); Likely benign(1)
Uncertain significance(1); Likely benign(1)
2
criteria provided, conflicting classifications
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.4079_*9dup (p.Leu1360_Ter1361=)
Variation ID: 927819 Accession: VCV000927819.6
- Type and length
-
Duplication, 14 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806855-47806856 (GRCh38) [ NCBI UCSC ] 2: 48033994-48033995 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jun 22, 2020 Feb 28, 2024 May 5, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.4079_*9dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Leu1360_Ter1361= no sequence alteration NM_001281492.2:c.3689_*9dup NP_001268421.1:p.Leu1230_Ter1231= no sequence alteration NM_001281493.2:c.3173_*9dup NP_001268422.1:p.Leu1058_Ter1059= no sequence alteration NM_001281494.2:c.3173_*9dup NP_001268423.1:p.Leu1058_Ter1059= no sequence alteration NM_001406795.1:c.4175_*9dup NP_001393724.1:p.Leu1392_Ter1393= no sequence alteration NM_001406796.1:c.4079_*9dup NP_001393725.1:p.Leu1360_Ter1361= no sequence alteration NM_001406797.1:c.3782_*9dup NP_001393726.1:p.Leu1261_Ter1262= no sequence alteration NM_001406798.1:c.3905_*9dup NP_001393727.1:p.Leu1302_Ter1303= no sequence alteration NM_001406799.1:c.3554_*9dup NP_001393728.1:p.Leu1185_Ter1186= no sequence alteration NM_001406800.1:c.*100_*113dup 3 prime UTR NM_001406801.1:c.*60_*73dup 3 prime UTR NM_001406802.1:c.*60_*73dup 3 prime UTR NM_001406803.1:c.3215_*9dup NP_001393732.1:p.Leu1072_Ter1073= no sequence alteration NM_001406804.1:c.4001_*9dup NP_001393733.1:p.Leu1334_Ter1335= no sequence alteration NM_001406805.1:c.3782_*9dup NP_001393734.1:p.Leu1261_Ter1262= no sequence alteration NM_001406806.1:c.3554_*9dup NP_001393735.1:p.Leu1185_Ter1186= no sequence alteration NM_001406807.1:c.3554_*9dup NP_001393736.1:p.Leu1185_Ter1186= no sequence alteration NM_001406808.1:c.*60_*73dup 3 prime UTR NM_001406809.1:c.4079_*9dup NP_001393738.1:p.Leu1360_Ter1361= no sequence alteration NM_001406811.1:c.3173_*9dup NP_001393740.1:p.Leu1058_Ter1059= no sequence alteration NM_001406812.1:c.3173_*9dup NP_001393741.1:p.Leu1058_Ter1059= no sequence alteration NM_001406813.1:c.4085_*9dup NP_001393742.1:p.Leu1362_Ter1363= no sequence alteration NM_001406814.1:c.3173_*9dup NP_001393743.1:p.Leu1058_Ter1059= no sequence alteration NM_001406815.1:c.3173_*9dup NP_001393744.1:p.Leu1058_Ter1059= no sequence alteration NM_001406816.1:c.3173_*9dup NP_001393745.1:p.Leu1058_Ter1059= no sequence alteration NM_001406817.1:c.2513_*9dup NP_001393746.1:p.Leu838_Ter839= no sequence alteration NM_001406818.1:c.3782_*9dup NP_001393747.1:p.Leu1261_Ter1262= no sequence alteration NM_001406819.1:c.3782_*9dup NP_001393748.1:p.Leu1261_Ter1262= no sequence alteration NM_001406820.1:c.3782_*9dup NP_001393749.1:p.Leu1261_Ter1262= no sequence alteration NM_001406821.1:c.3782_*9dup NP_001393750.1:p.Leu1261_Ter1262= no sequence alteration NM_001406822.1:c.*60_*73dup 3 prime UTR NM_001406823.1:c.3173_*9dup NP_001393752.1:p.Leu1058_Ter1059= no sequence alteration NM_001406824.1:c.3782_*9dup NP_001393753.1:p.Leu1261_Ter1262= no sequence alteration NM_001406825.1:c.3782_*9dup NP_001393754.1:p.Leu1261_Ter1262= no sequence alteration NM_001406826.1:c.3911_*9dup NP_001393755.1:p.Leu1304_Ter1305= no sequence alteration NM_001406827.1:c.3782_*9dup NP_001393756.1:p.Leu1261_Ter1262= no sequence alteration NM_001406828.1:c.3782_*9dup NP_001393757.1:p.Leu1261_Ter1262= no sequence alteration NM_001406829.1:c.3173_*9dup NP_001393758.1:p.Leu1058_Ter1059= no sequence alteration NM_001406830.1:c.3782_*9dup NP_001393759.1:p.Leu1261_Ter1262= no sequence alteration NM_001406831.1:c.860_*9dup NP_001393760.1:p.Leu287_Ter288= no sequence alteration NM_001406832.1:c.926_*9dup NP_001393761.1:p.Leu309_Ter310= no sequence alteration NM_001407362.1:c.2024_*9dup NP_001394291.1:p.Leu675_Ter676= no sequence alteration NR_176256.1:n.3009_3022dup non-coding transcript variant NR_176257.1:n.4340_4353dup non-coding transcript variant NR_176258.1:n.4269_4282dup non-coding transcript variant NR_176259.1:n.4168_4181dup non-coding transcript variant NR_176260.1:n.2113_2126dup NR_176261.1:n.4050_4063dup non-coding transcript variant NC_000002.12:g.47806856_47806869dup NC_000002.11:g.48033995_48034008dup NG_007111.1:g.28710_28723dup NG_008397.1:g.103807_103820dup LRG_219:g.28710_28723dup LRG_219t1:c.4079_*9dup LRG_219p1:p.Leu1360_Ter(1361_?)(?) - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806855:TATAGACTGACTAC:TATAGACTGACTACTATAGACTGACTAC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9161 | 9479 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Likely benign (1) |
criteria provided, single submitter
|
Mar 4, 2017 | RCV001191319.2 | |
| Uncertain significance (1) |
criteria provided, single submitter
|
May 5, 2023 | RCV001863037.4 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Likely benign
(Mar 04, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV001359080.1
First in ClinVar: Jun 22, 2020 Last updated: Jun 22, 2020 |
|
|
|
Uncertain significance
(May 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary nonpolyposis colorectal neoplasms
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV002282879.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 28, 2024 |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more)
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 927819). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant occurs in a non-coding region of the MSH6 gene. It does not change the encoded amino acid sequence of the MSH6 protein. (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 927819). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant occurs in a non-coding region of the MSH6 gene. It does not change the encoded amino acid sequence of the MSH6 protein.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs1670228993 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.