VCV000655295.9 - ClinVar

NM_001077365.2(POMT1):c.1837_1852dup (p.Gly618fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001077365.2(POMT1):c.1837_1852dup (p.Gly618fs)

Variation ID: 655295 Accession: VCV000655295.9

Type and length

Duplication, 16 bp

Location

Cytogenetic: 9q34.13 9: 131522050-131522051 (GRCh38) [ NCBI UCSC ] 9: 134397437-134397438 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 14, 2019	Feb 28, 2024	Apr 30, 2019

HGVS

Nucleotide	Protein	Molecular consequence
NM_001077365.2:c.1837_1852dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001070833.1:p.Gly618fs	frameshift
NM_001077366.2:c.1675_1690dup	NP_001070834.1:p.Gly564fs	frameshift
NM_001136113.2:c.1837_1852dup	NP_001129585.1:p.Gly618fs	frameshift
NM_001136114.2:c.1486_1501dup	NP_001129586.1:p.Gly501fs	frameshift
NM_001353193.2:c.1903_1918dup	NP_001340122.2:p.Gly640fs	frameshift
NM_001353194.2:c.1675_1690dup	NP_001340123.1:p.Gly564fs	frameshift
NM_001353195.2:c.1486_1501dup	NP_001340124.1:p.Gly501fs	frameshift
NM_001353196.2:c.1747_1762dup	NP_001340125.1:p.Gly588fs	frameshift
NM_001353197.2:c.1741_1756dup	NP_001340126.2:p.Gly586fs	frameshift
NM_001353198.2:c.1741_1756dup	NP_001340127.2:p.Gly586fs	frameshift
NM_001353199.2:c.1552_1567dup	NP_001340128.2:p.Gly523fs	frameshift
NM_001353200.2:c.1381_1396dup	NP_001340129.1:p.Gly466fs	frameshift
NM_001374689.1:c.1825_1840dup	NP_001361618.1:p.Gly614fs	frameshift
NM_001374690.1:c.1618_1633dup	NP_001361619.1:p.Gly545fs	frameshift
NM_001374691.1:c.1486_1501dup	NP_001361620.1:p.Gly501fs	frameshift
NM_001374692.1:c.1486_1501dup	NP_001361621.1:p.Gly501fs	frameshift
NM_001374693.1:c.1486_1501dup	NP_001361622.1:p.Gly501fs	frameshift
NM_001374695.1:c.1447_1462dup	NP_001361624.1:p.Gly488fs	frameshift
NM_007171.3:c.1903_1918dup16		frameshift
NM_007171.4:c.1903_1918dup	NP_009102.4:p.Gly640fs	frameshift
NR_148391.2:n.1871_1886dup		non-coding transcript variant
NR_148392.2:n.2089_2104dup		non-coding transcript variant
NR_148393.2:n.2010_2025dup		non-coding transcript variant
NR_148394.2:n.1764_1779dup		non-coding transcript variant
NR_148395.2:n.2162_2177dup		non-coding transcript variant
NR_148396.2:n.1796_1811dup		non-coding transcript variant
NR_148397.2:n.1921_1936dup		non-coding transcript variant
NR_148398.2:n.1876_1891dup		non-coding transcript variant
NR_148399.2:n.2402_2417dup		non-coding transcript variant
NR_148400.2:n.2001_2016dup		non-coding transcript variant
NC_000009.12:g.131522058_131522073dup
NC_000009.11:g.134397445_134397460dup
NG_008896.1:g.24157_24172dup
LRG_842t1:c.1903_1918dup	LRG_842p1:p.Gly640fs
LRG_842t2:c.1837_1852dup	LRG_842p2:p.Gly618fs

... more HGVS ... less HGVS

Protein change

G545fs, G488fs, G501fs, G523fs, G614fs, G618fs, G466fs, G564fs, G586fs, G640fs, G588fs

Other names

Canonical SPDI

NC_000009.12:131522050:CTGGCTGCGCTGGGTGCTGGCTG:CTGGCTGCGCTGGGTGCTGGCTGCGCTGGGTGCTGGCTG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1315540509 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
POMT1		-	-	GRCh38 GRCh37	1161	1202

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Autosomal recessive limb-girdle muscular dystrophy type 2K Muscular dystrophy-dystroglycanopathy (congenital with intellectual disability), type B1 Walker-Warburg congenital muscular dystrophy	Pathogenic (1)	criteria provided, single submitter	Apr 30, 2019	RCV000811436.9

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Apr 30, 2019)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Muscular dystrophy-dystroglycanopathy (congenital with intellectual disability), type B1 Walker-Warburg congenital muscular dystrophy Autosomal recessive limb-girdle muscular dystrophy type 2K Explanation for multiple conditions: Uncertain. The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000951703.6 First in ClinVar: Aug 14, 2019 Last updated: Feb 28, 2024	Publications: PubMed (6) PubMed: 12369018‚ 22323514‚ 17559086‚ 16575835‚ 24491487‚ 24304607 Comment: This sequence change results in a premature translational stop signal in the POMT1 gene (p.Gly640Alafs96). While this is not anticipated to result in nonsense mediated … (more) This sequence change results in a premature translational stop signal in the POMT1 gene (p.Gly640Alafs96). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 108 amino acids of the POMT1 protein. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with POMT1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant disrupts the C-terminus of the POMT1 protein. Other variant(s) that disrupt this region (p.Asp723Glyfs*8) have been determined to be pathogenic (PMID: 12369018, 22323514, 17559086, 16575835, 24491487, 24304607). This suggests that variants that disrupt this region of the protein are likely to be causative of disease. For these reasons, this variant has been classified as Pathogenic. (less)

Comment:

This sequence change results in a premature translational stop signal in the POMT1 gene (p.Gly640Alafs*96). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 108 amino acids of the POMT1 protein. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with POMT1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant disrupts the C-terminus of the POMT1 protein. Other variant(s) that disrupt this region (p.Asp723Glyfs*8) have been determined to be pathogenic (PMID: 12369018, 22323514, 17559086, 16575835, 24491487, 24304607). This suggests that variants that disrupt this region of the protein are likely to be causative of disease. For these reasons, this variant has been classified as Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
A novel missense mutation in POMT1 modulates the severe congenital muscular dystrophy phenotype associated with POMT1 nonsense mutations.	Wallace SE	Neuromuscular disorders : NMD	2014	PMID: 24491487
Detection limit of intragenic deletions with targeted array comparative genomic hybridization.	Askree SH	BMC genetics	2013	PMID: 24304607
Cobblestone lissencephaly: neuropathological subtypes and correlations with genes of dystroglycanopathies.	Devisme L	Brain : a journal of neurology	2012	PMID: 22323514
Molecular heterogeneity in fetal forms of type II lissencephaly.	Bouchet C	Human mutation	2007	PMID: 17559086
The expanding phenotype of POMT1 mutations: from Walker-Warburg syndrome to congenital muscular dystrophy, microcephaly, and mental retardation.	van Reeuwijk J	Human mutation	2006	PMID: 16575835
Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker-Warburg syndrome.	Beltrán-Valero de Bernabé D	American journal of human genetics	2002	PMID: 12369018

Text-mined citations for rs1315540509 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_001077365.2(POMT1):c.1837_1852dup (p.Gly618fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1315540509 ...