ClinVar Genomic variation as it relates to human health
NM_000492.4(CFTR):c.100_117del (p.Leu34_Gln39del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000492.4(CFTR):c.100_117del (p.Leu34_Gln39del)
Variation ID: 53164 Accession: VCV000053164.7
- Type and length
-
Deletion, 18 bp
- Location
-
Cytogenetic: 7q31.2 7: 117504297-117504314 (GRCh38) [ NCBI UCSC ] 7: 117144351-117144368 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jan 25, 2018 May 1, 2024 Aug 4, 2021 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000492.4:c.100_117del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000483.3:p.Leu34_Gln39del inframe deletion NM_000492.3:c.100_117delTTGTCAGACATATACCAA NC_000007.14:g.117504299_117504316del NC_000007.13:g.117144353_117144370del NG_016465.4:g.43516_43533del LRG_663:g.43516_43533del LRG_663t1:c.100_117del18 - Protein change
- Other names
- -
- Canonical SPDI
- NC_000007.14:117504296:AATTGTCAGACATATACCAA:AA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
CFTR | - | - |
GRCh38 GRCh37 |
3821 | 5195 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic/Likely pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
Aug 4, 2021 | RCV000577512.8 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Nov 05, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Cystic fibrosis
Affected status: yes
Allele origin:
unknown
|
Mendelics
Accession: SCV000886164.2
First in ClinVar: Jan 25, 2018 Last updated: Dec 11, 2022 |
|
|
Likely pathogenic
(Jun 10, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Cystic fibrosis
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002748711.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.100_117del18 variant (also known as p.L34_Q39del) is located in coding exon 2 of the CFTR gene. This variant results from an in-frame TTGTCAGACATATACCAA deletion … (more)
The c.100_117del18 variant (also known as p.L34_Q39del) is located in coding exon 2 of the CFTR gene. This variant results from an in-frame TTGTCAGACATATACCAA deletion at nucleotide positions 100 to 117. This results in the in-frame deletion of six amino acids between codons 34 and 39. This alteration has been identified in multiple individuals with suspected Cystic Fibrosis, however, further details were not provided (Pepermans X et al. Clin Biochem, 2016 Jan;49:154-60; Cambraia A et al. Dis Markers, 2021 Feb;2021:9812074). Additionally, this alteration was identified in two individuals with Cystic Fibrosis based on positive sweat tests and pancreatic insufficiency. Both individuals also carried F508del, one confirmed in trans (Faucz FR et al. Clin Genet, 2007 Sep;72:218-23; Martins RDS et al. Mol Genet Genomic Med, 2019 07;7:e00645). This amino acid region is highly conserved in available vertebrate species. This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic. (less)
|
|
Pathogenic
(Aug 04, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Cystic fibrosis
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV002170582.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 14, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 53164). This variant is also known … (more)
For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 53164). This variant is also known as 232del18. This variant has been observed in individual(s) with clinical features of cystic fibrosis (PMID: 17718859, 26500004, 31199594). In at least one individual the data is consistent with the variant being in trans (on the opposite chromosome) from a pathogenic variant. This variant is not present in population databases (ExAC no frequency). This variant, c.100_117del, results in the deletion of 6 amino acid(s) of the CFTR protein (p.Leu34_Gln39del), but otherwise preserves the integrity of the reading frame. (less)
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
CFTR-related disorders
Affected status: yes
Allele origin:
germline
|
ClinVar Staff, National Center for Biotechnology Information (NCBI)
Accession: SCV000678874.1
First in ClinVar: Jan 25, 2018 Last updated: Jan 25, 2018 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Next-Generation Sequencing for Molecular Diagnosis of Cystic Fibrosis in a Brazilian Cohort. | Cambraia A | Disease markers | 2021 | PMID: 33613790 |
Identification of a novel large deletion and other copy number variations in the CFTR gene in patients with Cystic Fibrosis from a multiethnic population. | Martins RDS | Molecular genetics & genomic medicine | 2019 | PMID: 31199594 |
Identification and frequencies of cystic fibrosis mutations in central Argentina. | Pepermans X | Clinical biochemistry | 2016 | PMID: 26500004 |
Cystic fibrosis in a southern Brazilian population: characteristics of 90% of the alleles. | Faucz FR | Clinical genetics | 2007 | PMID: 17718859 |
Text-mined citations for rs397508141 ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.