ClinVar Genomic variation as it relates to human health

This variant changes 1 nucleotide in exon 4 of the BARD1 gene, creating a premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has been identified in 2/250994 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BARD1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic.

Variant summary: BARD1 c.1205C>A (p.Ser402X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (eg. c.1690C>T (p.Gln564X), c.1921C>T (p.Arg641X), c.1935_1954dupTGAACAGGAAGAAAAGTATG (p.Glu652fsX69)). The variant allele was found at a frequency of 8.1e-06 in 245726 control chromosomes (gnomAD). To our knowledge, no occurrence of c.1205C>A in individuals affected with Hereditary Breast and Ovarian Cancer and no experimental evidence demonstrating its impact on protein function have been reported. One other clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation, and classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic.

This variant is considered pathogenic. This variant creates a termination codon and is predicted to result in premature protein truncation.

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 490923). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. This variant is present in population databases (rs796666047, gnomAD 0.002%). This sequence change creates a premature translational stop signal (p.Ser402*) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236).

The p.S402* pathogenic mutation (also known as c.1205C>A), located in coding exon 4 of the BARD1 gene, results from a C to A substitution at nucleotide position 1205. This changes the amino acid from a serine to a stop codon within coding exon 4. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.