VCV000447196.36 - ClinVar

NM_000092.5(COL4A4):c.914_930+29del

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(6)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000092.5(COL4A4):c.914_930+29del

Variation ID: 447196 Accession: VCV000447196.36

Type and length

Deletion, 46 bp

Location

Cytogenetic: 2q36.3 2: 227102760-227102805 (GRCh38) [ NCBI UCSC ] 2: 227967476-227967521 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 19, 2017	Oct 20, 2024	Mar 26, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_000092.5:c.914_930+29del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		splice donor
NC_000002.12:g.227102762_227102807del
NC_000002.11:g.227967478_227967523del
NG_011592.1:g.66755_66800del
LRG_231:g.66755_66800del
LRG_231t1:c.914_930+29del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000002.12:227102759:CACTGATGTTAACAGCAAATGATGCTTACCCGAGGCCCTGGAAATCCA:CA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA658657245 dbSNP: rs1553683757 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
COL4A4		-	-	GRCh38 GRCh37	2972	3008

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic/Likely pathogenic (5)	criteria provided, multiple submitters, no conflicts	Nov 14, 2023	RCV000517878.37
Autosomal recessive Alport syndrome	Pathogenic (1)	criteria provided, single submitter	Mar 26, 2024	RCV003989548.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 21, 2016)	criteria provided, single submitter (Athena Diagnostics Criteria) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Athena Diagnostics Accession: SCV000612979.2 First in ClinVar: Dec 19, 2017 Last updated: Dec 19, 2017	Publications: PubMed (1) PubMed: 9792860
Likely pathogenic (Oct 25, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001801903.3 First in ClinVar: Aug 21, 2021 Last updated: Mar 04, 2023	Comment: Canonical splice site variant predicted to result in in-frame deletion within a critical region. Variant damages or destroys the canonical splice donor site in intron … (more) Canonical splice site variant predicted to result in in-frame deletion within a critical region. Variant damages or destroys the canonical splice donor site in intron 15, and is expected to cause abnormal gene splicing; if the splice outcome is exon skip, the loss of the encoded residues in the triple helical region is expected to disrupt normal protein folding and function; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9792860) (less)
Likely pathogenic (Jun 01, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV002023310.3 First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024
Pathogenic (Nov 14, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001376020.5 First in ClinVar: Jul 16, 2020 Last updated: Feb 20, 2024	Publications: PubMed (5) PubMed: 16199547‚ 21196518‚ 24854265‚ 25307543‚ 9792860 Comment: This variant results in the deletion of part of exon 15 (c.914_930+29del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that … (more) This variant results in the deletion of part of exon 15 (c.914_930+29del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in COL4A4 are known to be pathogenic (PMID: 21196518, 24854265, 25307543). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Alport syndrome (PMID: 9792860; Invitae). It has also been observed to segregate with disease in related individuals. This variant is also known as 1122del46bp. ClinVar contains an entry for this variant (Variation ID: 447196). For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Mar 26, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Autosomal recessive Alport syndrome Affected status: unknown Allele origin: germline	Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center Accession: SCV004807250.1 First in ClinVar: Apr 06, 2024 Last updated: Apr 06, 2024
Pathogenic (Apr 01, 2021)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV001746407.20 First in ClinVar: Jul 10, 2021 Last updated: Oct 20, 2024	Number of individuals with the variant: 2

Comment:

Canonical splice site variant predicted to result in in-frame deletion within a critical region. Variant damages or destroys the canonical splice donor site in intron 15, and is expected to cause abnormal gene splicing; if the splice outcome is exon skip, the loss of the encoded residues in the triple helical region is expected to disrupt normal protein folding and function; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9792860)

Comment:

This variant results in the deletion of part of exon 15 (c.914_930+29del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in COL4A4 are known to be pathogenic (PMID: 21196518, 24854265, 25307543). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Alport syndrome (PMID: 9792860; Invitae). It has also been observed to segregate with disease in related individuals. This variant is also known as 1122del46bp. ClinVar contains an entry for this variant (Variation ID: 447196). For these reasons, this variant has been classified as Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Collagen type IV-related nephropathies in Portugal: pathogenic COL4A3 and COL4A4 mutations and clinical characterization of 25 families.	Nabais Sá MJ	Clinical genetics	2015	PMID: 25307543
Improving mutation screening in familial hematuric nephropathies through next generation sequencing.	Morinière V	Journal of the American Society of Nephrology : JASN	2014	PMID: 24854265
Rapid identification of a disease allele in mouse through whole genome sequencing and bulk segregation analysis.	Arnold CN	Genetics	2011	PMID: 21196518
Splicing in action: assessing disease causing sequence changes.	Baralle D	Journal of medical genetics	2005	PMID: 16199547
Determination of the genomic structure of the COL4A4 gene and of novel mutations causing autosomal recessive Alport syndrome.	Boye E	American journal of human genetics	1998	PMID: 9792860

Text-mined citations for rs1553683757 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_000092.5(COL4A4):c.914_930+29del

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1553683757 ...