ClinVar Genomic variation as it relates to human health
NM_007294.4(BRCA1):c.5277+48_5277+59dup
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_007294.4(BRCA1):c.5277+48_5277+59dup
Variation ID: 433729 Accession: VCV000433729.36
- Type and length
-
Duplication, 12 bp
- Location
-
Cytogenetic: 17q21.31 17: 43056992-43056993 (GRCh38) [ NCBI UCSC ] 17: 41209009-41209010 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 28, 2017 Oct 8, 2024 Jun 18, 2019 - HGVS
- ... more HGVS ... less HGVS
- Protein change
- Other names
- -
- Canonical SPDI
- NC_000017.11:43056992:GGAGTGGAATAC:GGAGTGGAATACGGAGTGGAATAC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
1000 Genomes Project 30x 0.00031
The Genome Aggregation Database (gnomAD) 0.00187
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
BRCA1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
13037 | 14843 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely benign (1) |
criteria provided, single submitter
|
- | RCV000500478.9 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Sep 30, 2020 | RCV000584229.11 | |
Benign (2) |
reviewed by expert panel
|
Jun 18, 2019 | RCV001003380.11 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Sep 12, 2023 | RCV001518145.14 | |
Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Aug 1, 2024 | RCV001799671.18 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Benign
(Jun 18, 2019)
|
reviewed by expert panel
Method: curation
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Accession: SCV001161515.2
First in ClinVar: Feb 16, 2020 Last updated: Jan 07, 2023 |
Comment:
IARC class based on posterior probability from multifactorial likelihood analysis, thresholds for class as per Plon et al. 2008 (PMID: 18951446). Class 1 based on … (more)
IARC class based on posterior probability from multifactorial likelihood analysis, thresholds for class as per Plon et al. 2008 (PMID: 18951446). Class 1 based on posterior probability = 0.000012 (less)
|
|
Likely benign
(-)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
Department of Pathology and Laboratory Medicine, Sinai Health System
Study: The Canadian Open Genetics Repository (COGR)
Accession: SCV000591603.1 First in ClinVar: Aug 28, 2017 Last updated: Aug 28, 2017 |
|
|
Likely benign
(Nov 16, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: yes
Allele origin:
germline
|
National Health Laboratory Service, Universitas Academic Hospital and University of the Free State
Accession: SCV002025905.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
Number of individuals with the variant: 2
Geographic origin: South Africa
Testing laboratory: National Health Laboratory Service (NHLS)
|
|
Benign
(Sep 30, 2020)
|
criteria provided, single submitter
Method: curation
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Sema4, Sema4
Accession: SCV002537831.1
First in ClinVar: Jun 24, 2022 Last updated: Jun 24, 2022 |
|
|
Likely benign
(May 10, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000688554.2
First in ClinVar: Feb 19, 2018 Last updated: Dec 11, 2022 |
|
|
Likely benign
(Jun 22, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV002044079.2
First in ClinVar: Jan 03, 2022 Last updated: Mar 04, 2023 |
Comment:
This variant is associated with the following publications: (PMID: 18424508, 22366370, 7606717, 18489799, 8531967)
|
|
Benign
(Sep 12, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001726792.4
First in ClinVar: Jun 15, 2021 Last updated: Feb 20, 2024 |
|
|
Likely benign
(Aug 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV004033561.10
First in ClinVar: Sep 16, 2023 Last updated: Oct 08, 2024 |
Comment:
BRCA1: BS3:Supporting, BS1
Number of individuals with the variant: 13
|
|
Benign
(Mar 02, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: yes
Allele origin:
germline
|
BRCAlab, Lund University
Accession: SCV004243928.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Prevalence of Clinically Relevant Germline BRCA Variants in a Large Unselected South African Breast and Ovarian Cancer Cohort: A Public Sector Experience. | Van der Merwe NC | Frontiers in genetics | 2022 | DOI: 10.3389/fgene.2022.834265 |
Large scale multifactorial likelihood quantitative analysis of BRCA1 and BRCA2 variants: An ENIGMA resource to support clinical variant classification. | Parsons MT | Human mutation | 2019 | PMID: 31131967 |
Text-mined citations for rs572766355 ...
HelpRecord last updated Oct 13, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.