VCV000039555.61 - ClinVar

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(22)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Variation ID: 39555 Accession: VCV000039555.61

Type and length

Deletion, 20 bp

Location

Cytogenetic: 1q21.2 1: 150553750-150553769 (GRCh38) [ NCBI UCSC ] 1: 150526234-150526253 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Sep 14, 2015	Oct 20, 2024	Mar 1, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_019032.6:c.767_786del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_061905.2:p.Gln256fs
NM_001288607.2:c.767_786del	NP_001275536.1:p.Gln256fs
NM_001288608.2:c.767_786del	NP_001275537.1:p.Gln256fs
NM_001378596.1:c.767_786del	NP_001365525.1:p.Gln256fs
NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCC
NM_019032.5:c.767_786delAGGCCTCTGGCACAGAGCCC
NM_025008.5:c.767_786del	NP_079284.2:p.Gln256fs
NC_000001.11:g.150553758_150553777del
NC_000001.10:g.150526234_150526253del
NG_012172.1:g.9337_9356del

... more HGVS ... less HGVS

Protein change

Q256fs

Other names

Canonical SPDI

NC_000001.11:150553749:CAGAGCCCAGGCCTCTGGCACAGAGCCC:CAGAGCCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

0.00060 (CAGAGCCC)

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA261176 OMIM: 610113.0003 dbSNP: rs199473693 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ADAMTSL4		-	-	GRCh38 GRCh37	422	1248
ADAMTSL4-AS2	-	-	-	GRCh38	-	788

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Ectopia lentis 2, isolated, autosomal recessive	Pathogenic (7)	criteria provided, multiple submitters, no conflicts	Dec 21, 2023	RCV000032754.19
Ectopia lentis et pupillae	Pathogenic (4)	criteria provided, single submitter	Apr 11, 2023	RCV000032753.10
not provided	Pathogenic (7)	criteria provided, multiple submitters, no conflicts	Mar 1, 2024	RCV000336254.39
Ectopia lentis	Pathogenic (1)	criteria provided, single submitter	Nov 14, 2014	RCV000844602.5
Craniosynostosis with ectopia lentis	Pathogenic (1)	no assertion criteria provided	Nov 1, 2021	RCV002243679.2
Ectopia lentis 2, isolated, autosomal recessive Ectopia lentis et pupillae	Pathogenic (2)	criteria provided, multiple submitters, no conflicts	Jul 21, 2022	RCV002504853.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 14, 2014)	criteria provided, single submitter (LMM Criteria) Method: clinical testing	Isolated ectopia lentis (Autosomal recessive inheritance) Affected status: not provided Allele origin: germline	Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine Accession: SCV000245573.1 First in ClinVar: Sep 14, 2015 Last updated: Sep 14, 2015	Publications: PubMed (4) PubMed: 20702823‚ 20564469‚ 21051722‚ 28642162 Comment: The p.Gln256ProfsX38 variant in ADAMTSL4 has been reported in >20 compound heter ozygous or homozygous individuals with ectopia lentis and was found to segregate with … (more) The p.Gln256ProfsX38 variant in ADAMTSL4 has been reported in >20 compound heter ozygous or homozygous individuals with ectopia lentis and was found to segregate with disease in 6 affected relatives from 5 families (Aragon -Martin 2010, Chri stensen 2010, Neuhann 2011, Chandra 2013, Overwater 2017). The p.Gln256ProfsX38 variant has been identified in 0.24% (306/126278) of European chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org/; dbSNP r s199473693). Although this variant has been seen in the general population, its frequency is low enough to be consistent with a recessive carrier frequency. Thi s variant is predicted to cause a frameshift, which alters the protein?s amino a cid sequence beginning at position 256 and leads to a premature termination codo n 38 amino acids downstream. This alteration has been shown to lead to a truncat ed mRNA (Christensen 2010) and is predicted to lead to a truncated or absent pro tein. Complete loss-of-function of the ADAMTSL4 gene is an established disease m echanism in individuals with ectopia lentis. In summary, this variant meets our criteria to be classified as pathogenic for ectopia lentis in an autosomal reces sive manner based upon segregation studies and the impact of the variant. ACMG/A MP Criteria applied: PVS1; PM3_Very strong; PP1_Moderate. (less) Number of individuals with the variant: 2
Pathogenic (May 09, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive Affected status: yes Allele origin: germline	MGZ Medical Genetics Center Accession: SCV002579170.1 First in ClinVar: Oct 15, 2022 Last updated: Oct 15, 2022 Comment: ACMG criteria applied: PVS1, PM1, PM3	Number of individuals with the variant: 5 Sex: male
Pathogenic (Sep 29, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive Ectopia lentis et pupillae Affected status: unknown Allele origin: unknown	Fulgent Genetics, Fulgent Genetics Accession: SCV002811537.1 First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022
Pathogenic (Apr 04, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000330034.7 First in ClinVar: Dec 06, 2016 Last updated: Mar 04, 2023	Comment: Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This … (more) Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 20564469, 22871183, 21051722, 27848971, 23426735, 20702823, 22736615, 28642162, 28394649, 31980526, 31282960, 34426522, 31589614, 33726816) (less)
Pathogenic (Sep 26, 2017)	criteria provided, single submitter (ICSL Variant Classification Criteria 09 May 2019) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive Affected status: unknown Allele origin: germline	Illumina Laboratory Services, Illumina Accession: SCV000915355.1 First in ClinVar: May 27, 2019 Last updated: May 27, 2019	Publications: PubMed (6) PubMed: 20702823‚ 21051722‚ 22736615‚ 20564469‚ 25975359‚ 22871183 Comment: The ADAMTSL4 c.767_786delAGGCCTCTGGCACAGAGCCC (p.Gln256ProfsTer38) variant results in a frameshift, and is predicted to result in premature termination of the protein. The p.Gln256ProfsTer38 variant has been … (more) The ADAMTSL4 c.767_786delAGGCCTCTGGCACAGAGCCC (p.Gln256ProfsTer38) variant results in a frameshift, and is predicted to result in premature termination of the protein. The p.Gln256ProfsTer38 variant has been reported in at least six studies in which it is found in a total of 39 individuals with ectopia lentis from at least 12 families, including in 33 individuals in a homozygous state (of whom at least 11 are related), five individuals in a compound heterozygous state and in one individual in a heterozygous state (Aragon-Martin et al. 2010; Christensen et al. 2010; Neuhann et al. 2011; Chandra et al. 2012; Chandra et al. 2013; Neuhann et al. 2015). The variant has also been found in a heterozygous state in eight unaffected family members. The p.Gln256ProfsTer38 variant was observed in a heterozygous state in five of 550 control individuals (Christensen et al. 2010; Neuhann et al. 2011) and is reported at a frequency of 0.002423 in the European (non-Finnish) population of the Genome Aggregation Database. Based on the evidence and the potential impact of frameshift variants, the p.Gln256ProfsTer38 variant is classified as pathogenic for ectopia lentis. This variant was observed by ICSL as part of a predisposition screen in an ostensibly healthy population. (less)
Pathogenic (Feb 01, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: not provided Allele origin: maternal	Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden Accession: SCV004025965.1 First in ClinVar: Aug 19, 2023 Last updated: Aug 19, 2023	Comment: PM3, PVS1, PP3, PP5, PS4, PP1
Pathogenic (Aug 11, 2016)	criteria provided, single submitter (EGL Classification Definitions 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Eurofins Ntd Llc (ga) Accession: SCV000344760.4 First in ClinVar: Dec 06, 2016 Last updated: Dec 15, 2018	Other databases http://www.egl-eurofins.com/emvc… http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=ADAMTSL4 Number of individuals with the variant: 1 Sex: mixed
Pathogenic (Dec 07, 2018)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: yes Allele origin: germline	Clinical Genetics and Genomics, Karolinska University Hospital Accession: SCV001450224.1 First in ClinVar: Dec 10, 2020 Last updated: Dec 10, 2020	Number of individuals with the variant: 1
Pathogenic (Dec 21, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive (Autosomal recessive inheritance) Affected status: yes Allele origin: germline	Victorian Clinical Genetics Services, Murdoch Childrens Research Institute Additional submitter: Shariant Australia, Australian Genomics Accession: SCV002768499.2 First in ClinVar: Dec 24, 2022 Last updated: Jul 23, 2024	Publications: PubMed (4) PubMed: 20564469‚ 21051722‚ 22338190‚ 35378950 Comment: Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism … (more) Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with ectopia lentis et pupillae (MIM#225200), isolated ectopia lentis (MIM#225100) and craniosynostosis with ectopia lentis (MONDO:0011347; PMID: 35378950). (I) 0106 - This gene is associated with autosomal recessive disease. (I) 0115 - Variants in this gene are known to have variable expressivity. Phenotype may vary significantly among patients, even within the same family (PMID: 22338190). (I) 0201 - Variant is predicted to cause nonsense-mediated decay (NMD) and loss of protein (premature termination codon is located at least 54 nucleotides upstream of the final exon-exon junction). (SP) 251 - This variant is heterozygous. (I) 0304 - Variant is present in gnomAD (v2) <0.01 for a recessive condition (344 heterozygotes, 0 homozygotes). (SP) 0701 - Many other NMD-predicted variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (DECIPHER). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been classified as pathogenic by multiple clinical laboratories in ClinVar, and has been observed in eight unrelated homozygous individuals and two compound heterozygous individuals with isolated ectopia lentis (PMID: 20564469, 21051722). (SP) 1201 - Heterozygous variant detected in trans with a second pathogenic heterozygous variant (NM_019032.5(ADAMTSL4):c.1656del; p.(Thr553Profs*32)) in a recessive disease. (I) 1206 - This variant has been shown to be paternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
Pathogenic (Jul 21, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis et pupillae Ectopia lentis 2, isolated, autosomal recessive Affected status: unknown Allele origin: germline	Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago Accession: SCV003924200.1 First in ClinVar: May 20, 2023 Last updated: May 20, 2023	Comment: This variant has been reported in the literature in the homozygous and compound heterozygous states in numerous individuals with ectopia lentis, segregating with disease in … (more) This variant has been reported in the literature in the homozygous and compound heterozygous states in numerous individuals with ectopia lentis, segregating with disease in at least 6 affected family members (Selected publications: Aragon-Martin 2010 PMID: 20564469; Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Chandra 2012 PMID: 22736615). This variant is present in 0.2% (307/128702) of European alleles in the Genome Aggregation Database (https://gnomad.broadinstitute.org/variant/1-150526225-CCAGAGCCCAGGCCTCTGGCA-C?dataset=gnomad_r2_1). Of note, this variant has been described as or suggested to be a founder mutation in multiple European populations (Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Overwater 2017 PMID: 28642162). This variant is present in ClinVar, with several laboratories classifying it as pathogenic (Variation ID: 39555). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant creates a premature stop codon 38 amino acids downstream from this location which results in an absent or abnormal protein; loss of function variants are a known mechanism of disease for this gene (Rødahl 2020 PMID: 22338190). In summary, this variant is classified as pathogenic. (less)
Pathogenic (Mar 01, 2024)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV002496911.18 First in ClinVar: Apr 08, 2022 Last updated: Oct 20, 2024	Comment: ADAMTSL4: PM3:Very Strong, PVS1, PP1:Strong, PM2:Supporting, PP4 Number of individuals with the variant: 8
Pathogenic (Jun 24, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive (Autosomal recessive inheritance) Affected status: yes Allele origin: germline	Genetics and Molecular Pathology, SA Pathology Additional submitter: Shariant Australia, Australian Genomics Accession: SCV002761619.1 First in ClinVar: Dec 17, 2022 Last updated: Dec 17, 2022	Publications: PubMed (4) PubMed: 20564469‚ 21051722‚ 22871183‚ 28642162 Comment: The ADAMTSL4 c.767_786del variant is classified as a PATHOGENIC VARIANT (PVS1, PS4, PP5) This variant is a 20-base pair deletion in exon 6 of the … (more) The ADAMTSL4 c.767_786del variant is classified as a PATHOGENIC VARIANT (PVS1, PS4, PP5) This variant is a 20-base pair deletion in exon 6 of the ADAMTSL4 gene which results in a frameshift starting with codon Glutamine 256, changes this amino acid to a Proline residue, and creates a premature Stop codon at position 38 of the new reading frame, denoted p.Q256PfsX38. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay (PVS1). This variant is common pathogenic variant in the ADAMTSL4 gene, and has been previously reported in many individuals with Ectopia lentis in both the homozygous or compound heterozygous state (PMID: 21051722, 22871183, 28642162, 20564469) (PS4). The variant is in dbSNP (rs199473693) and has been reported in population databases (gnomAD: 344/282186, 0 homozygote). The variant has been reported in ClinVar (Variation ID: 39555) and HGMD (Accession No: CD104803) as Pathogenic (PP5). (less)
Pathogenic (Apr 11, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive Affected status: no Allele origin: germline	Genome-Nilou Lab Accession: SCV004049171.1 First in ClinVar: Oct 28, 2023 Last updated: Oct 28, 2023
Pathogenic (Apr 11, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Ectopia lentis et pupillae Affected status: no Allele origin: germline	Genome-Nilou Lab Accession: SCV004049170.1 First in ClinVar: Oct 28, 2023 Last updated: Oct 28, 2023
Pathogenic (Jul 15, 2019)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV002022254.3 First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024
Pathogenic (May 04, 2022)	criteria provided, single submitter (Mendelics Assertion Criteria 2019) Method: clinical testing	Ectopia lentis 2, isolated, autosomal recessive Affected status: unknown Allele origin: germline	Mendelics Accession: SCV002517516.1 First in ClinVar: May 28, 2022 Last updated: May 28, 2022
Pathogenic (Jan 30, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001413157.4 First in ClinVar: Jul 16, 2020 Last updated: Feb 14, 2024	Publications: PubMed (7) PubMed: 20564469‚ 28642162‚ 2056446‚ 21051722‚ 22736615‚ 22871183‚ 25975359 Comment: This sequence change creates a premature translational stop signal (p.Gln256Profs38) in the ADAMTSL4 gene. It is expected to result in an absent or disrupted protein … (more) This sequence change creates a premature translational stop signal (p.Gln256Profs38) in the ADAMTSL4 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ADAMTSL4 are known to be pathogenic (PMID: 20564469, 28642162). This variant is present in population databases (rs587691401, gnomAD 0.2%), and has an allele count higher than expected for a pathogenic variant. This premature translational stop signal has been observed in individuals with ectopia lentis (PMID: 2056446, 21051722, 22736615, 22871183, 25975359). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 39555). For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Jul 24, 2012)	no assertion criteria provided Method: literature only	ECTOPIA LENTIS ET PUPILLAE Affected status: not provided Allele origin: germline	OMIM Accession: SCV000056517.3 First in ClinVar: Apr 04, 2013 Last updated: Jan 06, 2018	Publications: PubMed (4) PubMed: 20702823‚ 20564469‚ 21051722‚ 22736615 Comment on evidence: In 10 affected individuals from 5 Norwegian families with ectopia lentis et pupillae (225200), Christensen et al. (2010) identified homozygosity for a 20-bp deletion (767_786del20) … (more) In 10 affected individuals from 5 Norwegian families with ectopia lentis et pupillae (225200), Christensen et al. (2010) identified homozygosity for a 20-bp deletion (767_786del20) in the ADAMTSL4 gene, causing a frameshift predicted to result in a stop codon and premature termination 113 bp downstream. RT-PCR analysis of ADAMTSL4 mRNA confirmed the presence of a transcript truncated by 20 bp. Obligate heterozygotes had no ocular abnormalities. Homozygosity mapping in the 5 Norwegian families from Hordaland County in western Norway was compatible with a common ancestor 150 generations (4,000 years) earlier, and the mutation was found in heterozygosity in 3 of 190 local blood donors, corresponding to a prevalence for homozygosity of approximately 1:16,000 in this population. In 1 family, 1 of the 3 affected individuals had bilateral downward dislocation of the lenses but normally positioned pupils. In a 15-year-old boy with isolated ectopia lentis (ECTOL2; 252100), Aragon-Martin et al. (2010) identified homozygosity for the 20-bp deletion in exon 6 of the ADAMTSL4 gene. The 20-bp deletion was also identified in compound heterozygosity with an 11-bp deletion (826_836del11; 610113.0004) in ADAMTSL4 in 2 affected members of a Caucasian British family with ectopia lentis and in an 8-year-old Swedish boy with ectopia lentis et pupillae. In 8 patients from 7 German families with isolated ectopia lentis, Neuhann et al. (2011) identified homozygosity for the 20-bp deletion in the ADAMTSL4 gene, which they designated 759_778del20. The mutation was found in heterozygosity in unaffected parents and sibs, as well as in 2 of 360 controls. A 4-SNP haplotype was consistently associated with the mutation, suggestive of a founder mutation. In 6 Caucasian British patients with isolated ectopia lentis, Chandra et al. (2012) identified homozygosity for the ADAMTSL4 20-bp deletion (Gln256ProfsTer38). Two more Caucasian British patients, 1 with isolated ectopia lentis and 1 with ectopia lentis et pupillae, were found to be compound heterozygous for the 20-bp deletion and 2 different frameshift mutations: a 1-bp deletion (237delC, Pro80ArgfsTer53; 610113.0006) and a 1-bp duplication (2270dupG, Gly758TrpfsTer59; 610113.0007), respectively, in the ADAMTSL4 gene. (less)
Pathogenic (Jul 24, 2012)	no assertion criteria provided Method: literature only	ECTOPIA LENTIS 2, ISOLATED, AUTOSOMAL RECESSIVE Affected status: not provided Allele origin: germline	OMIM Accession: SCV000056518.3 First in ClinVar: Apr 04, 2013 Last updated: Jan 06, 2018	Publications: PubMed (4) PubMed: 20702823‚ 20564469‚ 21051722‚ 22736615 Comment on evidence: In 10 affected individuals from 5 Norwegian families with ectopia lentis et pupillae (225200), Christensen et al. (2010) identified homozygosity for a 20-bp deletion (767_786del20) … (more) In 10 affected individuals from 5 Norwegian families with ectopia lentis et pupillae (225200), Christensen et al. (2010) identified homozygosity for a 20-bp deletion (767_786del20) in the ADAMTSL4 gene, causing a frameshift predicted to result in a stop codon and premature termination 113 bp downstream. RT-PCR analysis of ADAMTSL4 mRNA confirmed the presence of a transcript truncated by 20 bp. Obligate heterozygotes had no ocular abnormalities. Homozygosity mapping in the 5 Norwegian families from Hordaland County in western Norway was compatible with a common ancestor 150 generations (4,000 years) earlier, and the mutation was found in heterozygosity in 3 of 190 local blood donors, corresponding to a prevalence for homozygosity of approximately 1:16,000 in this population. In 1 family, 1 of the 3 affected individuals had bilateral downward dislocation of the lenses but normally positioned pupils. In a 15-year-old boy with isolated ectopia lentis (ECTOL2; 252100), Aragon-Martin et al. (2010) identified homozygosity for the 20-bp deletion in exon 6 of the ADAMTSL4 gene. The 20-bp deletion was also identified in compound heterozygosity with an 11-bp deletion (826_836del11; 610113.0004) in ADAMTSL4 in 2 affected members of a Caucasian British family with ectopia lentis and in an 8-year-old Swedish boy with ectopia lentis et pupillae. In 8 patients from 7 German families with isolated ectopia lentis, Neuhann et al. (2011) identified homozygosity for the 20-bp deletion in the ADAMTSL4 gene, which they designated 759_778del20. The mutation was found in heterozygosity in unaffected parents and sibs, as well as in 2 of 360 controls. A 4-SNP haplotype was consistently associated with the mutation, suggestive of a founder mutation. In 6 Caucasian British patients with isolated ectopia lentis, Chandra et al. (2012) identified homozygosity for the ADAMTSL4 20-bp deletion (Gln256ProfsTer38). Two more Caucasian British patients, 1 with isolated ectopia lentis and 1 with ectopia lentis et pupillae, were found to be compound heterozygous for the 20-bp deletion and 2 different frameshift mutations: a 1-bp deletion (237delC, Pro80ArgfsTer53; 610113.0006) and a 1-bp duplication (2270dupG, Gly758TrpfsTer59; 610113.0007), respectively, in the ADAMTSL4 gene. (less)
Pathogenic (Nov 01, 2021)	no assertion criteria provided Method: research	Craniosynostosis with ectopia lentis (Autosomal recessive inheritance) Affected status: yes Allele origin: inherited	Cunningham Lab, Seattle Childrens Research Institute Accession: SCV002025267.1 First in ClinVar: May 21, 2022 Last updated: May 21, 2022	Publications: PubMed (3) PubMed: 20702823‚ 22871183‚ 28642162
not provided (-)	no classification provided Method: phenotyping only	Ectopia lentis et pupillae Affected status: unknown Allele origin: unknown	GenomeConnect - Invitae Patient Insights Network Accession: SCV001749619.1 First in ClinVar: Jul 18, 2021 Last updated: Jul 18, 2021	Comment: Variant interpreted as Pathogenic and reported on 06-26-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report … (more) Variant interpreted as Pathogenic and reported on 06-26-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. (less) Clinical Features: Abnormality of eye movement (present) , Myopia (present) , Abnormal oral cavity morphology (present) , Abnormal skull morphology (present) , Abnormality of the cardiovascular system … (more) Abnormality of eye movement (present) , Myopia (present) , Abnormal oral cavity morphology (present) , Abnormal skull morphology (present) , Abnormality of the cardiovascular system (present) , Abnormal cardiovascular system morphology (present) , Immunodeficiency (present) , Abnormal inflammatory response (present) , Recurrent infections (present) , Feeding difficulties (present) , Abnormal intestine morphology (present) , Abnormal stomach morphology (present) , Tall stature (present) , Abnormal curvature of the vertebral column (present) , EEG abnormality (present) , Generalized hypotonia (present) , Seizure (present) , Abnormality of the amniotic fluid (present) , Decreased fetal movement (present) (less) Indication for testing: Diagnostic Age: 30-39 years Sex: female Testing laboratory: Invitae Date variant was reported to submitter: 2017-06-26 Testing laboratory interpretation: Pathogenic
not provided (-)	no classification provided Method: literature only	Ectopia lentis et pupillae Affected status: unknown Allele origin: germline	GeneReviews Accession: SCV002586999.1 First in ClinVar: Oct 29, 2022 Last updated: Oct 29, 2022	Publications: PubMed (5) PubMed: 20564469‚ 20702823‚ 21051722‚ 22736615‚ 25975359 Bookshelf: NBK84111 Bookshelf: NBK84111
click to load more click to collapse

Comment:

The p.Gln256ProfsX38 variant in ADAMTSL4 has been reported in >20 compound heter ozygous or homozygous individuals with ectopia lentis and was found to segregate with disease in 6 affected relatives from 5 families (Aragon -Martin 2010, Chri stensen 2010, Neuhann 2011, Chandra 2013, Overwater 2017). The p.Gln256ProfsX38 variant has been identified in 0.24% (306/126278) of European chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org/; dbSNP r s199473693). Although this variant has been seen in the general population, its frequency is low enough to be consistent with a recessive carrier frequency. Thi s variant is predicted to cause a frameshift, which alters the protein?s amino a cid sequence beginning at position 256 and leads to a premature termination codo n 38 amino acids downstream. This alteration has been shown to lead to a truncat ed mRNA (Christensen 2010) and is predicted to lead to a truncated or absent pro tein. Complete loss-of-function of the ADAMTSL4 gene is an established disease m echanism in individuals with ectopia lentis. In summary, this variant meets our criteria to be classified as pathogenic for ectopia lentis in an autosomal reces sive manner based upon segregation studies and the impact of the variant. ACMG/A MP Criteria applied: PVS1; PM3_Very strong; PP1_Moderate.

Comment:

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 20564469, 22871183, 21051722, 27848971, 23426735, 20702823, 22736615, 28642162, 28394649, 31980526, 31282960, 34426522, 31589614, 33726816)

Comment:

The ADAMTSL4 c.767_786delAGGCCTCTGGCACAGAGCCC (p.Gln256ProfsTer38) variant results in a frameshift, and is predicted to result in premature termination of the protein. The p.Gln256ProfsTer38 variant has been reported in at least six studies in which it is found in a total of 39 individuals with ectopia lentis from at least 12 families, including in 33 individuals in a homozygous state (of whom at least 11 are related), five individuals in a compound heterozygous state and in one individual in a heterozygous state (Aragon-Martin et al. 2010; Christensen et al. 2010; Neuhann et al. 2011; Chandra et al. 2012; Chandra et al. 2013; Neuhann et al. 2015). The variant has also been found in a heterozygous state in eight unaffected family members. The p.Gln256ProfsTer38 variant was observed in a heterozygous state in five of 550 control individuals (Christensen et al. 2010; Neuhann et al. 2011) and is reported at a frequency of 0.002423 in the European (non-Finnish) population of the Genome Aggregation Database. Based on the evidence and the potential impact of frameshift variants, the p.Gln256ProfsTer38 variant is classified as pathogenic for ectopia lentis. This variant was observed by ICSL as part of a predisposition screen in an ostensibly healthy population.

Comment:

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with ectopia lentis et pupillae (MIM#225200), isolated ectopia lentis (MIM#225100) and craniosynostosis with ectopia lentis (MONDO:0011347; PMID: 35378950). (I) 0106 - This gene is associated with autosomal recessive disease. (I) 0115 - Variants in this gene are known to have variable expressivity. Phenotype may vary significantly among patients, even within the same family (PMID: 22338190). (I) 0201 - Variant is predicted to cause nonsense-mediated decay (NMD) and loss of protein (premature termination codon is located at least 54 nucleotides upstream of the final exon-exon junction). (SP) 251 - This variant is heterozygous. (I) 0304 - Variant is present in gnomAD (v2) <0.01 for a recessive condition (344 heterozygotes, 0 homozygotes). (SP) 0701 - Many other NMD-predicted variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (DECIPHER). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been classified as pathogenic by multiple clinical laboratories in ClinVar, and has been observed in eight unrelated homozygous individuals and two compound heterozygous individuals with isolated ectopia lentis (PMID: 20564469, 21051722). (SP) 1201 - Heterozygous variant detected in trans with a second pathogenic heterozygous variant (NM_019032.5(ADAMTSL4):c.1656del; p.(Thr553Profs*32)) in a recessive disease. (I) 1206 - This variant has been shown to be paternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign

Comment:

This variant has been reported in the literature in the homozygous and compound heterozygous states in numerous individuals with ectopia lentis, segregating with disease in at least 6 affected family members (Selected publications: Aragon-Martin 2010 PMID: 20564469; Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Chandra 2012 PMID: 22736615). This variant is present in 0.2% (307/128702) of European alleles in the Genome Aggregation Database (https://gnomad.broadinstitute.org/variant/1-150526225-CCAGAGCCCAGGCCTCTGGCA-C?dataset=gnomad_r2_1). Of note, this variant has been described as or suggested to be a founder mutation in multiple European populations (Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Overwater 2017 PMID: 28642162). This variant is present in ClinVar, with several laboratories classifying it as pathogenic (Variation ID: 39555). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant creates a premature stop codon 38 amino acids downstream from this location which results in an absent or abnormal protein; loss of function variants are a known mechanism of disease for this gene (Rødahl 2020 PMID: 22338190). In summary, this variant is classified as pathogenic.

Comment:

The ADAMTSL4 c.767_786del variant is classified as a PATHOGENIC VARIANT (PVS1, PS4, PP5) This variant is a 20-base pair deletion in exon 6 of the ADAMTSL4 gene which results in a frameshift starting with codon Glutamine 256, changes this amino acid to a Proline residue, and creates a premature Stop codon at position 38 of the new reading frame, denoted p.Q256PfsX38. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay (PVS1). This variant is common pathogenic variant in the ADAMTSL4 gene, and has been previously reported in many individuals with Ectopia lentis in both the homozygous or compound heterozygous state (PMID: 21051722, 22871183, 28642162, 20564469) (PS4). The variant is in dbSNP (rs199473693) and has been reported in population databases (gnomAD: 344/282186, 0 homozygote). The variant has been reported in ClinVar (Variation ID: 39555) and HGMD (Accession No: CD104803) as Pathogenic (PP5).

Comment:

This sequence change creates a premature translational stop signal (p.Gln256Profs*38) in the ADAMTSL4 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ADAMTSL4 are known to be pathogenic (PMID: 20564469, 28642162). This variant is present in population databases (rs587691401, gnomAD 0.2%), and has an allele count higher than expected for a pathogenic variant. This premature translational stop signal has been observed in individuals with ectopia lentis (PMID: 2056446, 21051722, 22736615, 22871183, 25975359). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 39555). For these reasons, this variant has been classified as Pathogenic.

Comment:

Variant interpreted as Pathogenic and reported on 06-26-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Mechanism of Disease: Recessive ADAMTSL4 Mutations and Craniosynostosis with Ectopia Lentis.	Gustafson J	Case reports in genetics	2022	PMID: 35378950
ADAMTSL4-Related Eye Disorders.	Adam MP	-	2020	PMID: 22338190
NGS panel analysis in 24 ectopia lentis patients; a clinically relevant test with a high diagnostic yield.	Overwater E	European journal of medical genetics	2017	PMID: 28642162
ADAMTSL4-associated isolated ectopia lentis: Further patients, novel mutations and a detailed phenotype description.	Neuhann TM	American journal of medical genetics. Part A	2015	PMID: 25975359
Craniosynostosis with ectopia lentis and a homozygous 20-base deletion in ADAMTSL4.	Chandra A	Ophthalmic genetics	2013	PMID: 22871183
A genotype-phenotype comparison of ADAMTSL4 and FBN1 in isolated ectopia lentis.	Chandra A	Investigative ophthalmology & visual science	2012	PMID: 22736615
A homozygous microdeletion within ADAMTSL4 in patients with isolated ectopia lentis: evidence of a founder mutation.	Neuhann TM	Investigative ophthalmology & visual science	2011	PMID: 21051722
A novel ADAMTSL4 mutation in autosomal recessive ectopia lentis et pupillae.	Christensen AE	Investigative ophthalmology & visual science	2010	PMID: 20702823
Role of ADAMTSL4 mutations in FBN1 mutation-negative ectopia lentis patients.	Aragon-Martin JA	Human mutation	2010	PMID: 20564469
[Effect of inclusion complexation of decanoic acid with alpha-cyclodextrin on rectal absorption of cefmetazole sodium suppository in rabbits].	Yanagi H	Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan	1991	PMID: 2056446
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=ADAMTSL4	-	-	-	-
click to load more click to collapse

Text-mined citations for rs199473693 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs199473693 ...