ClinVar Genomic variation as it relates to human health
NM_003060.4(SLC22A5):c.254_264dup (p.Ile89fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_003060.4(SLC22A5):c.254_264dup (p.Ile89fs)
Variation ID: 38790 Accession: VCV000038790.49
- Type and length
-
Duplication, 11 bp
- Location
-
Cytogenetic: 5q31.1 5: 132370222-132370223 (GRCh38) [ NCBI UCSC ] 5: 131705914-131705915 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 23, 2014 Oct 8, 2024 Mar 16, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_003060.4:c.254_264dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_003051.1:p.Ile89fs frameshift NM_001308122.2:c.254_264dup NP_001295051.1:p.Ile89fs frameshift NM_003060.3:c.254_264dupGGCTCGCCACC NC_000005.10:g.132370226_132370236dup NC_000005.9:g.131705918_131705928dup NG_008982.2:g.5523_5533dup - Protein change
- I89fs
- Other names
- I89GfsX45
- Canonical SPDI
- NC_000005.10:132370222:ACCGGCTCGCCACC:ACCGGCTCGCCACCGGCTCGCCACC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
SLC22A5 | - | - |
GRCh38 GRCh37 |
1173 | 1216 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (7) |
criteria provided, multiple submitters, no conflicts
|
Mar 16, 2024 | RCV000022309.28 | |
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Dec 27, 2023 | RCV000186155.31 | |
Pathogenic (1) |
no assertion criteria provided
|
Aug 26, 2020 | RCV002226450.9 | |
Pathogenic (1) |
no assertion criteria provided
|
Jan 16, 2024 | RCV003483445.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Aug 04, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000698147.1
First in ClinVar: May 23, 2014 Last updated: May 23, 2014 |
Comment:
Variant summary: The SLC22A5 c.254_264dup11 (p.Ile89Glyfs) variant results in a premature termination codon, predicted to cause a truncated or absent SLC22A5 protein due to nonsense … (more)
Variant summary: The SLC22A5 c.254_264dup11 (p.Ile89Glyfs) variant results in a premature termination codon, predicted to cause a truncated or absent SLC22A5 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. One in silico tool predicts a damaging outcome for this variant. This variant is absent in 42704 control chromosomes. This variant has been reported in multiple PCD patients both homozygously and heterozygously. Functional study showed this variant caused decreased levels of mature mRNA. In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic. (less)
|
|
Pathogenic
(Dec 27, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000239181.8
First in ClinVar: Jul 18, 2015 Last updated: Sep 16, 2024 |
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This … (more)
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 16652335, 31980526, 11715001, 21922592, 23379544, 28841266, 15714519) (less)
|
|
Pathogenic
(Mar 16, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004201245.2
First in ClinVar: Dec 30, 2023 Last updated: Jun 17, 2024 |
|
|
Pathogenic
(May 04, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
germline
|
Mendelics
Accession: SCV002519751.1
First in ClinVar: May 28, 2022 Last updated: May 28, 2022 |
|
|
Pathogenic
(Jan 10, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002785724.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
Pathogenic
(Jan 01, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV001247709.25
First in ClinVar: May 12, 2020 Last updated: Oct 08, 2024 |
Number of individuals with the variant: 2
|
|
Pathogenic
(Jul 15, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: no
Allele origin:
germline
|
Genome-Nilou Lab
Accession: SCV002055797.1
First in ClinVar: Jan 12, 2022 Last updated: Jan 12, 2022 |
|
|
Pathogenic
(Jan 11, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000960663.6
First in ClinVar: Aug 14, 2019 Last updated: Feb 14, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Ile89Glyfs*45) in the SLC22A5 gene. It is expected to result in an absent or disrupted protein … (more)
This sequence change creates a premature translational stop signal (p.Ile89Glyfs*45) in the SLC22A5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SLC22A5 are known to be pathogenic (PMID: 9916797). This variant is present in population databases (rs757431170, gnomAD 0.02%). This premature translational stop signal has been observed in individual(s) with primary carnitine deficiency (PMID: 11715001, 28841266). ClinVar contains an entry for this variant (Variation ID: 38790). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Aug 26, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Carnitine deficiency
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002078287.1
First in ClinVar: Feb 13, 2022 Last updated: Feb 13, 2022 |
|
|
Pathogenic
(Aug 26, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Renal carnitine transport defect
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002107410.1
First in ClinVar: Mar 28, 2022 Last updated: Mar 28, 2022 |
|
|
Pathogenic
(Jan 16, 2024)
|
no assertion criteria provided
Method: clinical testing
|
Congenital myasthenic syndrome 20
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
unknown
|
Ricardo Maselli Laboratory, University of California Davis
Accession: SCV004231839.1
First in ClinVar: Jan 26, 2024 Last updated: Jan 26, 2024 |
Comment:
Congenital Myasthenic Syndrome with episodic apneas.
Clinical Features:
Ptosis (present)
Age: 0-9 years
Sex: male
Ethnicity/Population group: Caucasian
Geographic origin: South America
Testing laboratory: Genos
Date variant was reported to submitter: 2021-08-17
Testing laboratory interpretation: Pathogenic
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Functional and molecular studies in primary carnitine deficiency. | Frigeni M | Human mutation | 2017 | PMID: 28841266 |
Phenotype and genotype variation in primary carnitine deficiency. | Wang Y | Genetics in medicine : official journal of the American College of Medical Genetics | 2001 | PMID: 11715001 |
Primary systemic carnitine deficiency is caused by mutations in a gene encoding sodium ion-dependent carnitine transporter. | Nezu J | Nature genetics | 1999 | PMID: 9916797 |
Text-mined citations for rs377767449 ...
HelpRecord last updated Oct 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.