VCV000037253.1 - ClinVar

NM_002653.5(PITX1):c.765_799del (p.Ala256fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_002653.5(PITX1):c.765_799del (p.Ala256fs)

Variation ID: 37253 Accession: VCV000037253.1

Type and length

Deletion, 35 bp

Location

Cytogenetic: 5q31.1 5: 135028925-135028959 (GRCh38) [ NCBI UCSC ] 5: 134364615-134364649 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 9, 2018	Dec 9, 2018	Jun 1, 2012

HGVS

Nucleotide	Protein	Molecular consequence
NM_002653.5:c.765_799del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_002644.4:p.Ala256fs	frameshift
NC_000005.10:g.135028929_135028963del
NC_000005.9:g.134364619_134364653del
NG_012114.1:g.10316_10350del

Protein change

A256fs

Other names

Canonical SPDI

NC_000005.10:135028924:GAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCCGAGT:GAGT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA213051 OMIM: 602149.0002 dbSNP: rs730882191 VarSome

Comment on variant

NCBI staff reviewed the sequence information reported in PubMed 22258522 Fig. 1 to determine the location of this allele on the current reference sequence.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
PITX1		-	-	GRCh38 GRCh37	68	103

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Clubfoot	Pathogenic (1)	no assertion criteria provided	Jun 1, 2012	RCV000030814.5

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Jun 01, 2012)	no assertion criteria provided Method: literature only	CLUBFOOT, CONGENITAL, WITH OR WITHOUT DEFICIENCY OF LONG BONES AND/OR MIRROR-IMAGE POLYDACTYLY Affected status: not provided Allele origin: germline	OMIM Accession: SCV000053485.3 First in ClinVar: Apr 04, 2013 Last updated: Dec 09, 2018	Publications: PubMed (1) PubMed: 22258522 Comment on evidence: In an infant with bilateral preaxial polydactyly, talipes equinovarus, and right tibial hemimelia (119800), Klopocki et al. (2012) identified heterozygosity for a 35-bp deletion (765_799del) … (more) In an infant with bilateral preaxial polydactyly, talipes equinovarus, and right tibial hemimelia (119800), Klopocki et al. (2012) identified heterozygosity for a 35-bp deletion (765_799del) in exon 3 of the PITX1 gene, predicted to cause a frameshift and addition of 303 amino acids (Ala256ArgfsTer303), resulting in loss of the C-terminal part of the protein, including the 14-amino acid OAR domain. The mutation was not found in the unaffected mother or in 400 control chromosomes; DNA from the father was not available. (less)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Deletions in PITX1 cause a spectrum of lower-limb malformations including mirror-image polydactyly.	Klopocki E	European journal of human genetics : EJHG	2012	PMID: 22258522

Text-mined citations for rs730882191 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 17, 2024

ClinVar Genomic variation as it relates to human health

NM_002653.5(PITX1):c.765_799del (p.Ala256fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs730882191 ...