The c.4034_4042dupTAGATGCTG variant (also known as p.V1345_A1347dup), located in coding exon 10 of the MSH6 gene, results from an in-frame duplication of TAGATGCTG at nucleotide positions 4034 to 4042. This results in the duplication of 3 extra residues (VDA) between codons 1345 and 1347. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.4034_4042dup (p.Ala1347_Glu1348insValAspAla)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.4034_4042dup (p.Ala1347_Glu1348insValAspAla)
Variation ID: 3230577 Accession: VCV003230577.1
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806807-47806808 (GRCh38) [ NCBI UCSC ] 2: 48033946-48033947 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 1, 2024 May 1, 2024 Sep 26, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.4034_4042dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Ala1347_Glu1348insValAspAla inframe insertion NM_000179.2:c.4034_4042dupTAGATGCTG inframe indel NM_001281492.2:c.3644_3652dup NP_001268421.1:p.Ala1217_Glu1218insValAspAla inframe insertion NM_001281493.2:c.3128_3136dup NP_001268422.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001281494.2:c.3128_3136dup NP_001268423.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406795.1:c.4130_4138dup NP_001393724.1:p.Ala1379_Glu1380insValAspAla inframe insertion NM_001406796.1:c.4034_4042dup NP_001393725.1:p.Ala1347_Glu1348insValAspAla inframe insertion NM_001406797.1:c.3737_3745dup NP_001393726.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406798.1:c.3860_3868dup NP_001393727.1:p.Ala1289_Glu1290insValAspAla inframe insertion NM_001406799.1:c.3509_3517dup NP_001393728.1:p.Ala1172_Glu1173insValAspAla inframe insertion NM_001406800.1:c.*55_*63dup 3 prime UTR NM_001406801.1:c.*15_*23dup 3 prime UTR NM_001406802.1:c.*15_*23dup 3 prime UTR NM_001406803.1:c.3170_3178dup NP_001393732.1:p.Ala1059_Glu1060insValAspAla inframe insertion NM_001406804.1:c.3956_3964dup NP_001393733.1:p.Ala1321_Glu1322insValAspAla inframe insertion NM_001406805.1:c.3737_3745dup NP_001393734.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406806.1:c.3509_3517dup NP_001393735.1:p.Ala1172_Glu1173insValAspAla inframe insertion NM_001406807.1:c.3509_3517dup NP_001393736.1:p.Ala1172_Glu1173insValAspAla inframe insertion NM_001406808.1:c.*15_*23dup 3 prime UTR NM_001406809.1:c.4034_4042dup NP_001393738.1:p.Ala1347_Glu1348insValAspAla inframe insertion NM_001406811.1:c.3128_3136dup NP_001393740.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406812.1:c.3128_3136dup NP_001393741.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406813.1:c.4040_4048dup NP_001393742.1:p.Ala1349_Glu1350insValAspAla inframe insertion NM_001406814.1:c.3128_3136dup NP_001393743.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406815.1:c.3128_3136dup NP_001393744.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406816.1:c.3128_3136dup NP_001393745.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406817.1:c.2468_2476dup NP_001393746.1:p.Ala825_Glu826insValAspAla inframe insertion NM_001406818.1:c.3737_3745dup NP_001393747.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406819.1:c.3737_3745dup NP_001393748.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406820.1:c.3737_3745dup NP_001393749.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406821.1:c.3737_3745dup NP_001393750.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406822.1:c.*15_*23dup 3 prime UTR NM_001406823.1:c.3128_3136dup NP_001393752.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406824.1:c.3737_3745dup NP_001393753.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406825.1:c.3737_3745dup NP_001393754.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406826.1:c.3866_3874dup NP_001393755.1:p.Ala1291_Glu1292insValAspAla inframe insertion NM_001406827.1:c.3737_3745dup NP_001393756.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406828.1:c.3737_3745dup NP_001393757.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406829.1:c.3128_3136dup NP_001393758.1:p.Ala1045_Glu1046insValAspAla inframe insertion NM_001406830.1:c.3737_3745dup NP_001393759.1:p.Ala1248_Glu1249insValAspAla inframe insertion NM_001406831.1:c.815_823dup NP_001393760.1:p.Ala274_Glu275insValAspAla inframe insertion NM_001406832.1:c.881_889dup NP_001393761.1:p.Ala296_Glu297insValAspAla inframe insertion NM_001407362.1:c.1979_1987dup NP_001394291.1:p.Ala662_Glu663insValAspAla inframe insertion NR_176256.1:n.2964_2972dup non-coding transcript variant NR_176257.1:n.4295_4303dup non-coding transcript variant NR_176258.1:n.4224_4232dup non-coding transcript variant NR_176259.1:n.4123_4131dup non-coding transcript variant NR_176260.1:n.2068_2076dup NR_176261.1:n.4005_4013dup non-coding transcript variant NC_000002.12:g.47806811_47806819dup NC_000002.11:g.48033950_48033958dup NG_007111.1:g.28665_28673dup NG_008397.1:g.103860_103868dup LRG_219:g.28665_28673dup LRG_219t1:c.4034_4042dup LRG_219p1:p.Ala1347_Glu1348insValAspAla - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806807:CTGTAGATGCTG:CTGTAGATGCTGTAGATGCTG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9161 | 9479 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
Sep 26, 2023 | RCV004520728.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(Sep 26, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV005032932.1
First in ClinVar: May 01, 2024 Last updated: May 01, 2024 |
Comment:
The c.4034_4042dupTAGATGCTG variant (also known as p.V1345_A1347dup), located in coding exon 10 of the MSH6 gene, results from an in-frame duplication of TAGATGCTG at nucleotide … (more)
The c.4034_4042dupTAGATGCTG variant (also known as p.V1345_A1347dup), located in coding exon 10 of the MSH6 gene, results from an in-frame duplication of TAGATGCTG at nucleotide positions 4034 to 4042. This results in the duplication of 3 extra residues (VDA) between codons 1345 and 1347. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
The c.4034_4042dupTAGATGCTG variant (also known as p.V1345_A1347dup), located in coding exon 10 of the MSH6 gene, results from an in-frame duplication of TAGATGCTG at nucleotide positions 4034 to 4042. This results in the duplication of 3 extra residues (VDA) between codons 1345 and 1347. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated May 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.