ClinVar Genomic variation as it relates to human health
NM_000548.5(TSC2):c.5387_5388insTCATCTCCTCGGTGGAGGACT (p.Leu1796_Ile1797insHisLeuLeuGlyGlyGlyLeu)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000548.5(TSC2):c.5387_5388insTCATCTCCTCGGTGGAGGACT (p.Leu1796_Ile1797insHisLeuLeuGlyGlyGlyLeu)
Variation ID: 3069892 Accession: VCV003069892.1
- Type and length
-
Insertion, 21 bp
- Location
-
Cytogenetic: 16p13.3 16: 2088571-2088572 (GRCh38) [ NCBI UCSC ] 16: 2138572-2138573 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 20, 2024 Apr 20, 2024 Mar 28, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000548.5:c.5387_5388insTCATCTCCTCGGTGGAGGACT MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000539.2:p.Leu1796_Ile1797insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001077183.3:c.5186_5187insTCATCTCCTCGGTGGAGGACT NP_001070651.1:p.Leu1729_Ile1730insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001114382.3:c.5318_5319insTCATCTCCTCGGTGGAGGACT NP_001107854.1:p.Leu1773_Ile1774insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001318827.2:c.5078_5079insTCATCTCCTCGGTGGAGGACT NP_001305756.1:p.Leu1693_Ile1694insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001318829.2:c.5042_5043insTCATCTCCTCGGTGGAGGACT NP_001305758.1:p.Leu1681_Ile1682insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001318831.2:c.4655_4656insTCATCTCCTCGGTGGAGGACT NP_001305760.1:p.Leu1552_Ile1553insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001318832.2:c.5219_5220insTCATCTCCTCGGTGGAGGACT NP_001305761.1:p.Leu1740_Ile1741insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001363528.2:c.5189_5190insTCATCTCCTCGGTGGAGGACT NP_001350457.1:p.Leu1730_Ile1731insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001370404.1:c.5255_5256insTCATCTCCTCGGTGGAGGACT NP_001357333.1:p.Leu1752_Ile1753insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001370405.1:c.5246_5247insTCATCTCCTCGGTGGAGGACT NP_001357334.1:p.Leu1749_Ile1750insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406663.1:c.5384_5385insTCATCTCCTCGGTGGAGGACT NP_001393592.1:p.Leu1795_Ile1796insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406664.1:c.5315_5316insTCATCTCCTCGGTGGAGGACT NP_001393593.1:p.Leu1772_Ile1773insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406665.1:c.5309_5310insTCATCTCCTCGGTGGAGGACT NP_001393594.1:p.Leu1770_Ile1771insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406667.1:c.5279_5280insTCATCTCCTCGGTGGAGGACT NP_001393596.1:p.Leu1760_Ile1761insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406668.1:c.5276_5277insTCATCTCCTCGGTGGAGGACT NP_001393597.1:p.Leu1759_Ile1760insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406670.1:c.5207_5208insTCATCTCCTCGGTGGAGGACT NP_001393599.1:p.Leu1736_Ile1737insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406671.1:c.5177_5178insTCATCTCCTCGGTGGAGGACT NP_001393600.1:p.Leu1726_Ile1727insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406673.1:c.5174_5175insTCATCTCCTCGGTGGAGGACT NP_001393602.1:p.Leu1725_Ile1726insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406675.1:c.5171_5172insTCATCTCCTCGGTGGAGGACT NP_001393604.1:p.Leu1724_Ile1725insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406676.1:c.5168_5169insTCATCTCCTCGGTGGAGGACT NP_001393605.1:p.Leu1723_Ile1724insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406677.1:c.5129_5130insTCATCTCCTCGGTGGAGGACT NP_001393606.1:p.Leu1710_Ile1711insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406678.1:c.5075_5076insTCATCTCCTCGGTGGAGGACT NP_001393607.1:p.Leu1692_Ile1693insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406679.1:c.5039_5040insTCATCTCCTCGGTGGAGGACT NP_001393608.1:p.Leu1680_Ile1681insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406680.1:c.4787_4788insTCATCTCCTCGGTGGAGGACT NP_001393609.1:p.Leu1596_Ile1597insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406681.1:c.4727_4728insTCATCTCCTCGGTGGAGGACT NP_001393610.1:p.Leu1576_Ile1577insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406682.1:c.4718_4719insTCATCTCCTCGGTGGAGGACT NP_001393611.1:p.Leu1573_Ile1574insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406683.1:c.4718_4719insTCATCTCCTCGGTGGAGGACT NP_001393612.1:p.Leu1573_Ile1574insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406684.1:c.4715_4716insTCATCTCCTCGGTGGAGGACT NP_001393613.1:p.Leu1572_Ile1573insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406685.1:c.4589_4590insTCATCTCCTCGGTGGAGGACT NP_001393614.1:p.Leu1530_Ile1531insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406686.1:c.4589_4590insTCATCTCCTCGGTGGAGGACT NP_001393615.1:p.Leu1530_Ile1531insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406687.1:c.4586_4587insTCATCTCCTCGGTGGAGGACT NP_001393616.1:p.Leu1529_Ile1530insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406688.1:c.4586_4587insTCATCTCCTCGGTGGAGGACT NP_001393617.1:p.Leu1529_Ile1530insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406689.1:c.3974_3975insTCATCTCCTCGGTGGAGGACT NP_001393618.1:p.Leu1325_Ile1326insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406690.1:c.3914_3915insTCATCTCCTCGGTGGAGGACT NP_001393619.1:p.Leu1305_Ile1306insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406691.1:c.3911_3912insTCATCTCCTCGGTGGAGGACT NP_001393620.1:p.Leu1304_Ile1305insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406692.1:c.3845_3846insTCATCTCCTCGGTGGAGGACT NP_001393621.1:p.Leu1282_Ile1283insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406693.1:c.3845_3846insTCATCTCCTCGGTGGAGGACT NP_001393622.1:p.Leu1282_Ile1283insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406694.1:c.3845_3846insTCATCTCCTCGGTGGAGGACT NP_001393623.1:p.Leu1282_Ile1283insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406695.1:c.3842_3843insTCATCTCCTCGGTGGAGGACT NP_001393624.1:p.Leu1281_Ile1282insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406696.1:c.3842_3843insTCATCTCCTCGGTGGAGGACT NP_001393625.1:p.Leu1281_Ile1282insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406697.1:c.3842_3843insTCATCTCCTCGGTGGAGGACT NP_001393626.1:p.Leu1281_Ile1282insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_001406698.1:c.3584_3585insTCATCTCCTCGGTGGAGGACT NP_001393627.1:p.Leu1195_Ile1196insHisLeuLeuGlyGlyGlyLeu inframe insertion NM_021055.3:c.5258_5259insTCATCTCCTCGGTGGAGGACT NP_066399.2:p.Leu1753_Ile1754insHisLeuLeuGlyGlyGlyLeu inframe insertion NR_176225.1:n.5339_5340insTCATCTCCTCGGTGGAGGACT non-coding transcript variant NR_176226.1:n.5587_5588insTCATCTCCTCGGTGGAGGACT non-coding transcript variant NR_176227.1:n.5515_5516insTCATCTCCTCGGTGGAGGACT non-coding transcript variant NR_176228.1:n.5336_5337insTCATCTCCTCGGTGGAGGACT non-coding transcript variant NR_176229.1:n.5261_5262insTCATCTCCTCGGTGGAGGACT non-coding transcript variant NC_000016.10:g.2088573_2088574insTCATCTCCTCGGTGGAGGACT NC_000016.9:g.2138574_2138575insTCATCTCCTCGGTGGAGGACT NG_005895.1:g.44268_44269insTCATCTCCTCGGTGGAGGACT NG_008617.1:g.54649_54650insTCCTCCACCGAGGAGATGAAG LRG_487:g.44268_44269insTCATCTCCTCGGTGGAGGACT LRG_487t1:c.5387_5388insTCATCTCCTCGGTGGAGGACT LRG_487p1:p.Leu1796_Ile1797insHisLeuLeuGlyGlyGlyLeu - Protein change
- Other names
- -
- Canonical SPDI
- NC_000016.10:2088571:CT:CTTCATCTCCTCGGTGGAGGACT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
TSC2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
10664 | 10858 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Uncertain significance (1) |
criteria provided, single submitter
|
Mar 28, 2023 | RCV004009924.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain Significance
(Mar 28, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Tuberous sclerosis syndrome
(Autosomal dominant inheritance)
Affected status: unknown
Allele origin:
germline
|
All of Us Research Program, National Institutes of Health
Accession: SCV004818088.1
First in ClinVar: Apr 20, 2024 Last updated: Apr 20, 2024
Comment:
This study involves interpretation of variants in research participants for the purpose of population health screening. Participant phenotype was not available at the time of … (more)
This study involves interpretation of variants in research participants for the purpose of population health screening. Participant phenotype was not available at the time of variant classification. Additional details can be found in publication PMID: 35346344, PMCID: PMC8962531 (less)
|
Number of individuals with the variant: 1
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Jun 02, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.