VCV002934975.1 - ClinVar

NM_001127649.3(PEX26):c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG (p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001127649.3(PEX26):c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG (p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly)

Variation ID: 2934975 Accession: VCV002934975.1

Type and length

Indel, 26 bp

Location

Cytogenetic: 22q11.21 22: 18078374-18078393 (GRCh38) [ NCBI UCSC ] 22: 18561140-18561159 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 29, 2024	Feb 28, 2024	Jun 7, 2021

HGVS

Nucleotide	Protein	Molecular consequence
NM_001127649.3:c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001121121.1:p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly	initiator codon variant
NM_001199319.2:c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG	NP_001186248.1:p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly	initiator codon variant
NM_017929.6:c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG	NP_060399.1:p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly	initiator codon variant
NC_000022.11:g.18078374_18078393delinsTGCAGCCCCCCTCAGGGGGCTCGGGG
NC_000022.10:g.18561140_18561159delinsTGCAGCCCCCCTCAGGGGGCTCGGGG
NG_008339.1:g.5455_5474delinsTGCAGCCCCCCTCAGGGGGCTCGGGG
NG_008339.2:g.5386_5405delinsTGCAGCCCCCCTCAGGGGGCTCGGGG
NG_201354.1:g.421_430delinsTGCAGCCCCCCTCAGGGGGCTCGGGG
NG_201355.1:g.121_140delinsTGCAGCCCCCCTCAGGGGGCTCGGGG

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000022.11:18078373:GTTATGAAGAGCGATTCTTC:TGCAGCCCCCCTCAGGGGGCTCGGGG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
LOC130066940	-	-	-	GRCh38	-	32
PEX26		-	-	GRCh38 GRCh37	543	637

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Peroxisome biogenesis disorder 7A (Zellweger) Peroxisome biogenesis disorder 7B	Likely pathogenic (1)	criteria provided, single submitter	Jun 7, 2021	RCV003798677.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Jun 07, 2021)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Peroxisome biogenesis disorder 7A (Zellweger) Peroxisome biogenesis disorder 7B Explanation for multiple conditions: Uncertain. The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004582425.1 First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024	Publications: PubMed (2) PubMed: 12851857‚ 28944237 Comment: In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has … (more) In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant disrupts the initiator methionine in PEX26. If translation initiates from the next in-frame methionine, the PEX26 protein would no longer include the region containing the p.Gly89 amino acid residue. Other variant(s) that disrupt this residue have been observed in individuals with PEX26-related conditions (PMID: 12851857), which suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. Disruption of the initiator codon ‚Äãhas been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 12851857, 28944237). This variant is not present in population databases (ExAC no frequency). This sequence change affects the initiator methionine of the PEX26 mRNA. The next in-frame methionine is located at codon 96. (less)

Comment:

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant disrupts the initiator methionine in PEX26. If translation initiates from the next in-frame methionine, the PEX26 protein would no longer include the region containing the p.Gly89 amino acid residue. Other variant(s) that disrupt this residue have been observed in individuals with PEX26-related conditions (PMID: 12851857), which suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. Disruption of the initiator codon ‚Äãhas been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 12851857, 28944237). This variant is not present in population databases (ExAC no frequency). This sequence change affects the initiator methionine of the PEX26 mRNA. The next in-frame methionine is located at codon 96.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Next-generation sequencing reveals the mutational landscape of clinically diagnosed Usher syndrome: copy number variations, phenocopies, a predominant target for translational read-through, and PEX26 mutated in Heimler syndrome.	Neuhaus C	Molecular genetics & genomic medicine	2017	PMID: 28944237
Mutations in novel peroxin gene PEX26 that cause peroxisome-biogenesis disorders of complementation group 8 provide a genotype-phenotype correlation.	Matsumoto N	American journal of human genetics	2003	PMID: 12851857

Text-mined citations for this variant ...

Record last updated Sep 30, 2024

ClinVar Genomic variation as it relates to human health

NM_001127649.3(PEX26):c.-3_17delinsTGCAGCCCCCCTCAGGGGGCTCGGGG (p.Met1_Ser6delinsSerProProGlnGlyAlaArgGly)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...