ClinVar Genomic variation as it relates to human health
NM_170707.4(LMNA):c.1417_1438dup (p.Thr480delinsLysTrpArgTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_170707.4(LMNA):c.1417_1438dup (p.Thr480delinsLysTrpArgTer)
Variation ID: 2829061 Accession: VCV002829061.1
- Type and length
-
Duplication, 22 bp
- Location
-
Cytogenetic: 1q22 1: 156136956-156136957 (GRCh38) [ NCBI UCSC ] 1: 156106747-156106748 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 20, 2024 Feb 20, 2024 Sep 14, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_170707.4:c.1417_1438dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_733821.1:p.Thr480delinsLysTrpArgTer nonsense NM_005572.4:c.1417_1438dup MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_005563.1:p.Thr480delinsLysTrpArgTer nonsense NM_001257374.3:c.1081_1102dup NP_001244303.1:p.Thr368delinsLysTrpArgTer nonsense NM_001282624.2:c.1174_1195dup NP_001269553.1:p.Thr399delinsLysTrpArgTer nonsense NM_001282625.2:c.1417_1438dup NP_001269554.1:p.Thr480delinsLysTrpArgTer nonsense NM_001282626.2:c.1417_1438dup NP_001269555.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406983.1:c.1417_1438dup NP_001393912.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406984.1:c.1417_1438dup NP_001393913.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406985.1:c.1417_1438dup NP_001393914.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406986.1:c.1174_1195dup NP_001393915.1:p.Thr399delinsLysTrpArgTer nonsense NM_001406987.1:c.1174_1195dup NP_001393916.1:p.Thr399delinsLysTrpArgTer nonsense NM_001406988.1:c.1120_1141dup NP_001393917.1:p.Thr381delinsLysTrpArgTer nonsense NM_001406989.1:c.1081_1102dup NP_001393918.1:p.Thr368delinsLysTrpArgTer nonsense NM_001406990.1:c.859_880dup NP_001393919.1:p.Thr294delinsLysTrpArgTer nonsense NM_001406991.1:c.1417_1438dup NP_001393920.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406992.1:c.1417_1438dup NP_001393921.1:p.Thr480delinsLysTrpArgTer nonsense NM_001406993.1:c.859_880dup NP_001393922.1:p.Thr294delinsLysTrpArgTer nonsense NM_001406994.1:c.793_814dup NP_001393923.1:p.Thr272delinsLysTrpArgTer nonsense NM_001406995.1:c.859_880dup NP_001393924.1:p.Thr294delinsLysTrpArgTer nonsense NM_001406996.1:c.859_880dup NP_001393925.1:p.Thr294delinsLysTrpArgTer nonsense NM_001406997.1:c.859_880dup NP_001393926.1:p.Thr294delinsLysTrpArgTer nonsense NM_001406998.1:c.1081_1102dup NP_001393927.1:p.Thr368delinsLysTrpArgTer nonsense NM_001406999.1:c.793_814dup NP_001393928.1:p.Thr272delinsLysTrpArgTer nonsense NM_001407000.1:c.793_814dup NP_001393929.1:p.Thr272delinsLysTrpArgTer nonsense NM_001407001.1:c.793_814dup NP_001393930.1:p.Thr272delinsLysTrpArgTer nonsense NM_001407002.1:c.859_880dup NP_001393931.1:p.Thr294delinsLysTrpArgTer nonsense NM_001407003.1:c.859_880dup NP_001393932.1:p.Thr294delinsLysTrpArgTer nonsense NM_170708.4:c.1417_1438dup NP_733822.1:p.Thr480delinsLysTrpArgTer nonsense NR_047544.1:n.2058_2079dup NR_047545.1:n.1305_1326dup NC_000001.11:g.156136957_156136978dup NC_000001.10:g.156106748_156106769dup NG_008692.2:g.59385_59406dup LRG_254:g.59385_59406dup LRG_254t1:c.1417_1438dup LRG_254p1:p.Thr480Lysfs LRG_254t2:c.1417_1438dup LRG_254p2:p.Thr480Lysfs LRG_254t3:c.1417_1438dup LRG_254p3:p.Thr480Lysfs - Protein change
- Other names
- -
- Canonical SPDI
- NC_000001.11:156136956:AATGGAGATGATCCCTTGCTGA:AATGGAGATGATCCCTTGCTGAAATGGAGATGATCCCTTGCTGA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
LMNA | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
1839 | 2119 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Sep 14, 2023 | RCV003744295.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Sep 14, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Charcot-Marie-Tooth disease type 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV004426918.1
First in ClinVar: Feb 20, 2024 Last updated: Feb 20, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with LMNA-related conditions. … (more)
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with LMNA-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Thr480Lysfs*4) in the LMNA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LMNA are known to be pathogenic (PMID: 18585512, 18926329). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Long-term outcome and risk stratification in dilated cardiolaminopathies. | Pasotti M | Journal of the American College of Cardiology | 2008 | PMID: 18926329 |
Lamin A/C mutation analysis in a cohort of 324 unrelated patients with idiopathic or familial dilated cardiomyopathy. | Parks SB | American heart journal | 2008 | PMID: 18585512 |
Text-mined citations for this variant ...
HelpRecord last updated Sep 30, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.