ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.3842_3873dup (p.Gly1292fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.3842_3873dup (p.Gly1292fs)
Variation ID: 2754813 Accession: VCV002754813.1
- Type and length
-
Duplication, 32 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806490-47806491 (GRCh38) [ NCBI UCSC ] 2: 48033629-48033630 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 14, 2024 Feb 14, 2024 Aug 24, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.3842_3873dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Gly1292fs frameshift NM_001281492.2:c.3452_3483dup NP_001268421.1:p.Gly1162fs frameshift NM_001281493.2:c.2936_2967dup NP_001268422.1:p.Gly990fs frameshift NM_001281494.2:c.2936_2967dup NP_001268423.1:p.Gly990fs frameshift NM_001406795.1:c.3938_3969dup NP_001393724.1:p.Gly1324fs frameshift NM_001406796.1:c.3842_3873dup NP_001393725.1:p.Gly1292fs frameshift NM_001406797.1:c.3545_3576dup NP_001393726.1:p.Gly1193fs frameshift NM_001406798.1:c.3668_3699dup NP_001393727.1:p.Gly1234fs frameshift NM_001406799.1:c.3317_3348dup NP_001393728.1:p.Gly1117fs frameshift NM_001406800.1:c.3829_3860dup NP_001393729.1:p.Arg1287_Glu1288insAspTyrTyrValProLeuTer nonsense inframe insertion NM_001406801.1:c.3545_3576dup NP_001393730.1:p.Gly1193fs frameshift NM_001406802.1:c.3897+134_3897+165dup intron variant NM_001406803.1:c.2978_3009dup NP_001393732.1:p.Gly1004fs frameshift NM_001406804.1:c.3764_3795dup NP_001393733.1:p.Gly1266fs frameshift NM_001406805.1:c.3545_3576dup NP_001393734.1:p.Gly1193fs frameshift NM_001406806.1:c.3317_3348dup NP_001393735.1:p.Gly1117fs frameshift NM_001406807.1:c.3317_3348dup NP_001393736.1:p.Gly1117fs frameshift NM_001406808.1:c.3842_3873dup NP_001393737.1:p.Gly1292fs frameshift NM_001406809.1:c.3842_3873dup NP_001393738.1:p.Gly1292fs frameshift NM_001406811.1:c.2936_2967dup NP_001393740.1:p.Gly990fs frameshift NM_001406812.1:c.2936_2967dup NP_001393741.1:p.Gly990fs frameshift NM_001406813.1:c.3848_3879dup NP_001393742.1:p.Gly1294fs frameshift NM_001406814.1:c.2936_2967dup NP_001393743.1:p.Gly990fs frameshift NM_001406815.1:c.2936_2967dup NP_001393744.1:p.Gly990fs frameshift NM_001406816.1:c.2936_2967dup NP_001393745.1:p.Gly990fs frameshift NM_001406817.1:c.2276_2307dup NP_001393746.1:p.Gly770fs frameshift NM_001406818.1:c.3545_3576dup NP_001393747.1:p.Gly1193fs frameshift NM_001406819.1:c.3545_3576dup NP_001393748.1:p.Gly1193fs frameshift NM_001406820.1:c.3545_3576dup NP_001393749.1:p.Gly1193fs frameshift NM_001406821.1:c.3545_3576dup NP_001393750.1:p.Gly1193fs frameshift NM_001406822.1:c.3545_3576dup NP_001393751.1:p.Gly1193fs frameshift NM_001406823.1:c.2936_2967dup NP_001393752.1:p.Gly990fs frameshift NM_001406824.1:c.3545_3576dup NP_001393753.1:p.Gly1193fs frameshift NM_001406825.1:c.3545_3576dup NP_001393754.1:p.Gly1193fs frameshift NM_001406826.1:c.3674_3705dup NP_001393755.1:p.Gly1236fs frameshift NM_001406827.1:c.3545_3576dup NP_001393756.1:p.Gly1193fs frameshift NM_001406828.1:c.3545_3576dup NP_001393757.1:p.Gly1193fs frameshift NM_001406829.1:c.2936_2967dup NP_001393758.1:p.Gly990fs frameshift NM_001406830.1:c.3545_3576dup NP_001393759.1:p.Gly1193fs frameshift NM_001406831.1:c.623_654dup NP_001393760.1:p.Gly219fs frameshift NM_001406832.1:c.689_720dup NP_001393761.1:p.Gly241fs frameshift NM_001407362.1:c.1787_1818dup NP_001394291.1:p.Gly607fs frameshift NR_176256.1:n.2772_2803dup non-coding transcript variant NR_176257.1:n.4103_4134dup non-coding transcript variant NR_176258.1:n.4032_4063dup non-coding transcript variant NR_176259.1:n.3931_3962dup non-coding transcript variant NR_176260.1:n.1876_1907dup NR_176261.1:n.3813_3844dup non-coding transcript variant NC_000002.12:g.47806492_47806523dup NC_000002.11:g.48033631_48033662dup NG_007111.1:g.28346_28377dup NG_008397.1:g.104154_104185dup LRG_219:g.28346_28377dup LRG_219t1:c.3842_3873dup LRG_219p1:p.Gly1292Argfs - Protein change
- G1162fs, G1236fs, G1324fs, G241fs, G1004fs, G1117fs, G607fs, G770fs, G1266fs, G219fs, G1193fs, G1234fs, G1292fs, G1294fs, G990fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806490:GAGACTATTACGTTCCTCTATAAATTCATTAAG:GAGACTATTACGTTCCTCTATAAATTCATTAAGAGACTATTACGTTCCTCTATAAATTCATTAAG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9149 | 9460 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Aug 24, 2023 | RCV003593781.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Aug 24, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary nonpolyposis colorectal neoplasms
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV004315412.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Gly1292Argfs*46) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.Gly1292Argfs*46) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 69 amino acid(s) of the MSH6 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant disrupts a region of the MSH6 protein in which other variant(s) (p.Arg1331*) have been determined to be pathogenic (PMID: 16034045, 18301448, 20587412, 21056691). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Prevalence of alterations in DNA mismatch repair genes in patients with young-onset colorectal cancer. | Limburg PJ | Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association | 2011 | PMID: 21056691 |
Current clinical criteria for Lynch syndrome are not sensitive enough to identify MSH6 mutation carriers. | Sjursen W | Journal of medical genetics | 2010 | PMID: 20587412 |
No association between MUTYH and MSH6 germline mutations in 64 HNPCC patients. | Steinke V | European journal of human genetics : EJHG | 2008 | PMID: 18301448 |
Immunohistochemistry identifies carriers of mismatch repair gene defects causing hereditary nonpolyposis colorectal cancer. | Stormorken AT | Journal of clinical oncology : official journal of the American Society of Clinical Oncology | 2005 | PMID: 16034045 |
Text-mined citations for this variant ...
HelpRecord last updated Feb 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.