ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.2020_2057del (p.Gly674fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.2020_2057del (p.Gly674fs)
Variation ID: 2673710 Accession: VCV002673710.1
- Type and length
-
Deletion, 38 bp
- Location
-
Cytogenetic: 2p16.3 2: 47800003-47800040 (GRCh38) [ NCBI UCSC ] 2: 48027142-48027179 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 25, 2023 Dec 24, 2023 Aug 16, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.2020_2057del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Gly674fs frameshift NM_001281492.2:c.1630_1667del NP_001268421.1:p.Gly544fs frameshift NM_001281493.2:c.1114_1151del NP_001268422.1:p.Gly372fs frameshift NM_001281494.2:c.1114_1151del NP_001268423.1:p.Gly372fs frameshift NM_001406795.1:c.2116_2153del NP_001393724.1:p.Gly706fs frameshift NM_001406796.1:c.2020_2057del NP_001393725.1:p.Gly674fs frameshift NM_001406797.1:c.1723_1760del NP_001393726.1:p.Gly575fs frameshift NM_001406798.1:c.2020_2057del NP_001393727.1:p.Gly674fs frameshift NM_001406799.1:c.1495_1532del NP_001393728.1:p.Gly499fs frameshift NM_001406800.1:c.2020_2057del NP_001393729.1:p.Gly674fs frameshift NM_001406801.1:c.1723_1760del NP_001393730.1:p.Gly575fs frameshift NM_001406802.1:c.2116_2153del NP_001393731.1:p.Gly706fs frameshift NM_001406803.1:c.2020_2057del NP_001393732.1:p.Gly674fs frameshift NM_001406804.1:c.1942_1979del NP_001393733.1:p.Gly648fs frameshift NM_001406805.1:c.1723_1760del NP_001393734.1:p.Gly575fs frameshift NM_001406806.1:c.1495_1532del NP_001393735.1:p.Gly499fs frameshift NM_001406807.1:c.1495_1532del NP_001393736.1:p.Gly499fs frameshift NM_001406808.1:c.2020_2057del NP_001393737.1:p.Gly674fs frameshift NM_001406809.1:c.2020_2057del NP_001393738.1:p.Gly674fs frameshift NM_001406811.1:c.1114_1151del NP_001393740.1:p.Gly372fs frameshift NM_001406812.1:c.1114_1151del NP_001393741.1:p.Gly372fs frameshift NM_001406813.1:c.2026_2063del NP_001393742.1:p.Gly676fs frameshift NM_001406814.1:c.1114_1151del NP_001393743.1:p.Gly372fs frameshift NM_001406815.1:c.1114_1151del NP_001393744.1:p.Gly372fs frameshift NM_001406816.1:c.1114_1151del NP_001393745.1:p.Gly372fs frameshift NM_001406817.1:c.1606+414_1606+451del intron variant NM_001406818.1:c.1723_1760del NP_001393747.1:p.Gly575fs frameshift NM_001406819.1:c.1723_1760del NP_001393748.1:p.Gly575fs frameshift NM_001406820.1:c.1723_1760del NP_001393749.1:p.Gly575fs frameshift NM_001406821.1:c.1723_1760del NP_001393750.1:p.Gly575fs frameshift NM_001406822.1:c.1723_1760del NP_001393751.1:p.Gly575fs frameshift NM_001406823.1:c.1114_1151del NP_001393752.1:p.Gly372fs frameshift NM_001406824.1:c.1723_1760del NP_001393753.1:p.Gly575fs frameshift NM_001406825.1:c.1723_1760del NP_001393754.1:p.Gly575fs frameshift NM_001406826.1:c.1852_1889del NP_001393755.1:p.Gly618fs frameshift NM_001406827.1:c.1723_1760del NP_001393756.1:p.Gly575fs frameshift NM_001406828.1:c.1723_1760del NP_001393757.1:p.Gly575fs frameshift NM_001406829.1:c.1114_1151del NP_001393758.1:p.Gly372fs frameshift NM_001406830.1:c.1723_1760del NP_001393759.1:p.Gly575fs frameshift NM_001407362.1:c.628-663_628-626del intron variant NR_176256.1:n.882_919del non-coding transcript variant NR_176257.1:n.2109_2146del non-coding transcript variant NR_176258.1:n.2109_2146del non-coding transcript variant NR_176259.1:n.2109_2146del non-coding transcript variant NR_176261.1:n.2109_2146del non-coding transcript variant NC_000002.12:g.47800003_47800040del NC_000002.11:g.48027142_48027179del NG_007111.1:g.21857_21894del LRG_219:g.21857_21894del LRG_219t1:c.2020_2057del38 LRG_219p1:p.Gly674Leufs - Protein change
- G372fs, G499fs, G544fs, G575fs, G618fs, G648fs, G674fs, G676fs, G706fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47800002:GGAGAGAAAAGTGAATTGGCCCTCTCTGCTCTAGGTGG:
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9148 | 9458 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Aug 16, 2023 | RCV003450347.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Aug 16, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 5
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004187205.1
First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Dec 30, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.