ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.3190_3224dup (p.Cys1075fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.3190_3224dup (p.Cys1075fs)
Variation ID: 2673601 Accession: VCV002673601.2
- Type and length
-
Duplication, 35 bp
- Location
-
Cytogenetic: 2p16.3 2: 47803434-47803435 (GRCh38) [ NCBI UCSC ] 2: 48030573-48030574 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 25, 2023 Feb 14, 2024 Aug 22, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.3190_3224dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Cys1075fs frameshift NM_001281492.2:c.2800_2834dup NP_001268421.1:p.Cys945fs frameshift NM_001281493.2:c.2284_2318dup NP_001268422.1:p.Cys773fs frameshift NM_001281494.2:c.2284_2318dup NP_001268423.1:p.Cys773fs frameshift NM_001406795.1:c.3286_3320dup NP_001393724.1:p.Cys1107fs frameshift NM_001406796.1:c.3190_3224dup NP_001393725.1:p.Cys1075fs frameshift NM_001406797.1:c.2893_2927dup NP_001393726.1:p.Cys976fs frameshift NM_001406798.1:c.3173-157_3173-123dup intron variant NM_001406799.1:c.2665_2699dup NP_001393728.1:p.Cys900fs frameshift NM_001406800.1:c.3190_3224dup NP_001393729.1:p.Cys1075fs frameshift NM_001406801.1:c.2893_2927dup NP_001393730.1:p.Cys976fs frameshift NM_001406802.1:c.3286_3320dup NP_001393731.1:p.Cys1107fs frameshift NM_001406803.1:c.2326_2360dup NP_001393732.1:p.Cys787fs frameshift NM_001406804.1:c.3112_3146dup NP_001393733.1:p.Cys1049fs frameshift NM_001406805.1:c.2893_2927dup NP_001393734.1:p.Cys976fs frameshift NM_001406806.1:c.2665_2699dup NP_001393735.1:p.Cys900fs frameshift NM_001406807.1:c.2665_2699dup NP_001393736.1:p.Cys900fs frameshift NM_001406808.1:c.3190_3224dup NP_001393737.1:p.Cys1075fs frameshift NM_001406809.1:c.3190_3224dup NP_001393738.1:p.Cys1075fs frameshift NM_001406811.1:c.2284_2318dup NP_001393740.1:p.Cys773fs frameshift NM_001406812.1:c.2284_2318dup NP_001393741.1:p.Cys773fs frameshift NM_001406813.1:c.3196_3230dup NP_001393742.1:p.Cys1077fs frameshift NM_001406814.1:c.2284_2318dup NP_001393743.1:p.Cys773fs frameshift NM_001406815.1:c.2284_2318dup NP_001393744.1:p.Cys773fs frameshift NM_001406816.1:c.2284_2318dup NP_001393745.1:p.Cys773fs frameshift NM_001406817.1:c.1624_1658dup NP_001393746.1:p.Cys553fs frameshift NM_001406818.1:c.2893_2927dup NP_001393747.1:p.Cys976fs frameshift NM_001406819.1:c.2893_2927dup NP_001393748.1:p.Cys976fs frameshift NM_001406820.1:c.2893_2927dup NP_001393749.1:p.Cys976fs frameshift NM_001406821.1:c.2893_2927dup NP_001393750.1:p.Cys976fs frameshift NM_001406822.1:c.2893_2927dup NP_001393751.1:p.Cys976fs frameshift NM_001406823.1:c.2284_2318dup NP_001393752.1:p.Cys773fs frameshift NM_001406824.1:c.2893_2927dup NP_001393753.1:p.Cys976fs frameshift NM_001406825.1:c.2893_2927dup NP_001393754.1:p.Cys976fs frameshift NM_001406826.1:c.3022_3056dup NP_001393755.1:p.Cys1019fs frameshift NM_001406827.1:c.2893_2927dup NP_001393756.1:p.Cys976fs frameshift NM_001406828.1:c.2893_2927dup NP_001393757.1:p.Cys976fs frameshift NM_001406829.1:c.2284_2318dup NP_001393758.1:p.Cys773fs frameshift NM_001406830.1:c.2893_2927dup NP_001393759.1:p.Cys976fs frameshift NM_001406831.1:c.-30_5dup NP_001393760.1:p.Cys2fs frameshift initiator codon variant NM_001406832.1:c.37_71dup NP_001393761.1:p.Cys24fs frameshift NM_001407362.1:c.1135_1169dup NP_001394291.1:p.Cys390fs frameshift NR_176256.1:n.2120_2154dup non-coding transcript variant NR_176257.1:n.3451_3485dup non-coding transcript variant NR_176258.1:n.3380_3414dup non-coding transcript variant NR_176259.1:n.3279_3313dup non-coding transcript variant NR_176260.1:n.1224_1258dup NR_176261.1:n.3279_3313dup non-coding transcript variant NC_000002.12:g.47803437_47803471dup NC_000002.11:g.48030576_48030610dup NG_007111.1:g.25291_25325dup LRG_219:g.25291_25325dup LRG_219t1:c.3190_3224dup LRG_219p1:p.Cys1075Trpfs - Protein change
- C1019fs, C1049fs, C1075fs, C1077fs, C1107fs, C24fs, C2fs, C390fs, C553fs, C773fs, C787fs, C900fs, C945fs, C976fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47803434:TGGCTAACTATAGTCGAGGGGGTGATGGTCCTATGTG:TGGCTAACTATAGTCGAGGGGGTGATGGTCCTATGTGGCTAACTATAGTCGAGGGGGTGATGGTCCTATGTG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9158 | 9474 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Aug 22, 2023 | RCV003450238.1 | |
Pathogenic (1) |
criteria provided, single submitter
|
May 17, 2023 | RCV003585398.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Aug 22, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 5
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004185640.1
First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
|
Pathogenic
(May 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV004357705.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
Comment:
This variant inserts 35 nucleotides in exon 5 of the MSH6 gene, creating a frameshift and premature translation stop signal. This variant is expected to … (more)
This variant inserts 35 nucleotides in exon 5 of the MSH6 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with MSH6-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of MSH6 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Oct 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.