This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
ClinVar Genomic variation as it relates to human health
NM_000251.3(MSH2):c.1862_1907del (p.Arg621fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000251.3(MSH2):c.1862_1907del (p.Arg621fs)
Variation ID: 2673475 Accession: VCV002673475.1
- Type and length
-
Deletion, 46 bp
- Location
-
Cytogenetic: 2p21 2: 47475126-47475171 (GRCh38) [ NCBI UCSC ] 2: 47702265-47702310 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 25, 2023 Dec 24, 2023 Aug 4, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000251.3:c.1862_1907del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000242.1:p.Arg621fs frameshift NM_001258281.1:c.1664_1709del NP_001245210.1:p.Arg555fs frameshift NM_001406631.1:c.1862_1907del NP_001393560.1:p.Arg621fs frameshift NM_001406632.1:c.1862_1907del NP_001393561.1:p.Arg621fs frameshift NM_001406633.1:c.1862_1907del NP_001393562.1:p.Arg621fs frameshift NM_001406634.1:c.1862_1907del NP_001393563.1:p.Arg621fs frameshift NM_001406635.1:c.1862_1907del NP_001393564.1:p.Arg621fs frameshift NM_001406636.1:c.1829_1874del NP_001393565.1:p.Arg610fs frameshift NM_001406637.1:c.1862_1907del NP_001393566.1:p.Arg621fs frameshift NM_001406638.1:c.1901_1946del NP_001393567.1:p.Arg634fs frameshift NM_001406639.1:c.1862_1907del NP_001393568.1:p.Arg621fs frameshift NM_001406640.1:c.1862_1907del NP_001393569.1:p.Arg621fs frameshift NM_001406641.1:c.1862_1907del NP_001393570.1:p.Arg621fs frameshift NM_001406642.1:c.1862_1907del NP_001393571.1:p.Arg621fs frameshift NM_001406643.1:c.1862_1907del NP_001393572.1:p.Arg621fs frameshift NM_001406644.1:c.1862_1907del NP_001393573.1:p.Arg621fs frameshift NM_001406645.1:c.1862_1907del NP_001393574.1:p.Arg621fs frameshift NM_001406646.1:c.1862_1907del NP_001393575.1:p.Arg621fs frameshift NM_001406647.1:c.1712_1757del NP_001393576.1:p.Arg571fs frameshift NM_001406648.1:c.1862_1907del NP_001393577.1:p.Arg621fs frameshift NM_001406649.1:c.1712_1757del NP_001393578.1:p.Arg571fs frameshift NM_001406650.1:c.1712_1757del NP_001393579.1:p.Arg571fs frameshift NM_001406651.1:c.1712_1757del NP_001393580.1:p.Arg571fs frameshift NM_001406652.1:c.1712_1757del NP_001393581.1:p.Arg571fs frameshift NM_001406653.1:c.1802_1847del NP_001393582.1:p.Arg601fs frameshift NM_001406654.1:c.1442_1487del NP_001393583.1:p.Arg481fs frameshift NM_001406655.1:c.1862_1907del NP_001393584.1:p.Arg621fs frameshift NM_001406656.1:c.965_1010del NP_001393585.1:p.Arg322fs frameshift NM_001406657.1:c.*72_*117del 3 prime UTR NM_001406658.1:c.506_551del NP_001393587.1:p.Arg169fs frameshift NM_001406659.1:c.506_551del NP_001393588.1:p.Arg169fs frameshift NM_001406660.1:c.506_551del NP_001393589.1:p.Arg169fs frameshift NM_001406661.1:c.506_551del NP_001393590.1:p.Arg169fs frameshift NM_001406662.1:c.506_551del NP_001393591.1:p.Arg169fs frameshift NM_001406669.1:c.506_551del NP_001393598.1:p.Arg169fs frameshift NM_001406674.1:c.1862_1907del NP_001393603.1:p.Arg621fs frameshift NR_176230.1:n.1898_1943del non-coding transcript variant NR_176231.1:n.1898_1943del non-coding transcript variant NR_176232.1:n.1898_1943del non-coding transcript variant NR_176233.1:n.1740_1785del non-coding transcript variant NR_176234.1:n.1898_1943del non-coding transcript variant NR_176235.1:n.1898_1943del non-coding transcript variant NR_176236.1:n.1898_1943del non-coding transcript variant NR_176237.1:n.1898_1943del non-coding transcript variant NR_176238.1:n.2031_2076del non-coding transcript variant NR_176239.1:n.1898_1943del non-coding transcript variant NR_176240.1:n.1898_1943del non-coding transcript variant NR_176241.1:n.1898_1943del non-coding transcript variant NR_176242.1:n.1898_1943del non-coding transcript variant NR_176243.1:n.1748_1793del non-coding transcript variant NR_176244.1:n.1898_1943del non-coding transcript variant NR_176245.1:n.1898_1943del non-coding transcript variant NR_176246.1:n.1898_1943del non-coding transcript variant NR_176247.1:n.1898_1943del non-coding transcript variant NR_176248.1:n.1898_1943del non-coding transcript variant NR_176249.1:n.2128_2173del non-coding transcript variant NR_176250.1:n.1638_1683del non-coding transcript variant NC_000002.12:g.47475127_47475172del NC_000002.11:g.47702266_47702311del NG_007110.2:g.77004_77049del LRG_218:g.77004_77049del LRG_218t1:c.1862_1907del46 LRG_218p1:p.Arg621Hisfs - Protein change
- R169fs, R322fs, R481fs, R555fs, R571fs, R601fs, R610fs, R621fs, R634fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47475125:CGACCAGCCATTTTGGAGAAAGGACAAGGAAGAATTATATTAAAAGC:C
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
7402 | 7564 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
criteria provided, single submitter
|
Aug 4, 2023 | RCV003450197.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Aug 04, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 1
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004188988.1
First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Jun 10, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.