VCV002664876.1 - ClinVar

NM_000478.6(ALPL):c.793-30_793-11del

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000478.6(ALPL):c.793-30_793-11del

Variation ID: 2664876 Accession: VCV002664876.1

Type and length

Deletion, 20 bp

Location

Cytogenetic: 1p36.12 1: 21570272-21570291 (GRCh38) [ NCBI UCSC ] 1: 21896765-21896784 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 17, 2023	Dec 17, 2023	Feb 14, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_000478.6:c.793-30_793-11del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		intron variant
NM_001127501.4:c.628-30_628-11del		intron variant
NM_001177520.3:c.562-30_562-11del		intron variant
NM_001369803.2:c.793-30_793-11del		intron variant
NM_001369804.2:c.793-30_793-11del		intron variant
NM_001369805.2:c.793-30_793-11del		intron variant
NC_000001.11:g.21570275_21570294del
NC_000001.10:g.21896768_21896787del
NG_008940.1:g.65911_65930del
NG_008940.2:g.66293_66312del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000001.11:21570271:CCCGGCATGTGCTGACACAGCCC:CCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ALPL		-	-	GRCh38 GRCh37	1213	1229

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Hypophosphatasia	Likely pathogenic (1)	criteria provided, single submitter	Feb 14, 2023	RCV003447850.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Feb 14, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Hypophosphatasia Affected status: yes Allele origin: germline	JKU Lab, Dept of Paediatrics, Johannes Kepler University Accession: SCV004174901.1 First in ClinVar: Dec 17, 2023 Last updated: Dec 17, 2023	Publications: PubMed (2) PubMed: 32811521‚ 27777120 Comment: Absent in GnomAD. The ACMG criteria applied can be looked up in the ALPL gene variant database. https://alplmutationdatabase.jku.at/

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Pediatric hypophosphatasia: lessons learned from a retrospective single-center chart review of 50 children.	Vogt M	Orphanet journal of rare diseases	2020	PMID: 32811521
A homozygous intronic branch-point deletion in the ALPL gene causes infantile hypophosphatasia.	Mentrup B	Bone	2017	PMID: 27777120

Text-mined citations for this variant ...

Record last updated Dec 17, 2023

ClinVar Genomic variation as it relates to human health

NM_000478.6(ALPL):c.793-30_793-11del

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...