Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic.
ClinVar Genomic variation as it relates to human health
NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(8)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic/Likely pathogenic
8
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)
Variation ID: 251358 Accession: VCV000251358.16
- Type and length
-
Duplication, 21 bp
- Location
-
Cytogenetic: 19p13.2 19: 11105565-11105566 (GRCh38) [ NCBI UCSC ] 19: 11216245-11216265 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Sep 30, 2017 Nov 30, 2024 Nov 19, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000527.5:c.663_683dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000518.1:p.Asp221_Asp227dup inframe insertion NM_000527.4:c.663_683dup21 NM_000527.4:c.663_683dupCTGCAAGGACAAATCTGACGA inframe insertion NM_001195798.2:c.663_683dup NP_001182727.1:p.Asp221_Asp227dup inframe insertion NM_001195799.2:c.540_560dup NP_001182728.1:p.Asp180_Asp186dup inframe insertion NM_001195800.2:c.314-1823_314-1803dup intron variant NM_001195803.2:c.314-996_314-976dup intron variant NC_000019.10:g.11105569_11105589dup NC_000019.9:g.11216245_11216265dup NG_009060.1:g.21189_21209dup LRG_274:g.21189_21209dup - Protein change
- -
- Other names
-
FH Tulsa-1
- Canonical SPDI
- NC_000019.10:11105565:CGACTGCAAGGACAAATCTGACGA:CGACTGCAAGGACAAATCTGACGACTGCAAGGACAAATCTGACGA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| LDLR | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
4126 | 4416 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Likely pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
Mar 25, 2016 | RCV000238041.5 | |
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Jan 8, 2024 | RCV000586459.11 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Mar 24, 2022 | RCV002365241.2 | |
| Likely pathogenic (1) |
criteria provided, single submitter
|
Nov 19, 2024 | RCV003327389.3 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Likely pathogenic
(Mar 25, 2016)
|
criteria provided, single submitter
Method: literature only
|
Familial hypercholesterolemia
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
LDLR-LOVD, British Heart Foundation
Accession: SCV000294864.2
First in ClinVar: Jul 29, 2016 Last updated: Dec 26, 2017 |
Observation 1:
Number of individuals with the variant: 1
Observation 2:
Number of individuals with the variant: 1
Observation 3:
Number of individuals with the variant: 1
Observation 4:
Number of individuals with the variant: 1
Observation 5:
Number of individuals with the variant: 1
|
|
|
Likely pathogenic
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
(Autosomal dominant inheritance)
Affected status: unknown
Allele origin:
germline
|
Fundacion Hipercolesterolemia Familiar
Study: SAFEHEART
Accession: SCV000607483.1 First in ClinVar: Sep 30, 2017 Last updated: Sep 30, 2017 |
Observation 1: Observation 2:
Comment on evidence:
Comp htz (with p.(Glu228Gln) / p.Asp482Asn) patients' fibroblasts, 125I-LDL and RNA assays
Result:
2-5% / <2% LDLR activity
|
|
|
Pathogenic
(Oct 23, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000697246.2
First in ClinVar: Mar 17, 2018 Last updated: May 31, 2019 |
Comment:
Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive … (more)
Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic. (less)
|
|
|
Pathogenic
(Jan 08, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000544677.8
First in ClinVar: Jul 29, 2016 Last updated: Feb 20, 2024 |
Comment:
This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial hypercholesterolemia and homozygous familial hypercholesterolemia (PMID: 1301956, 8599353, 9026534, 10447263, 16250003; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Mar 24, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002661892.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.663_683dup21 pathogenic mutation (also known as p.D221_D227dup), located in coding exon 4 of the LDLR gene, results from an in-frame duplication of 21 nucleotides … (more)
The c.663_683dup21 pathogenic mutation (also known as p.D221_D227dup), located in coding exon 4 of the LDLR gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 663 to 683. This results in the duplication of seven residues (DCKDKSD) between amino acids 221 and 227. This variant, also known as FH Tulsa-1, has been detected in individuals with homozygous familial hypercholesterolemia (FH), who had a second variant in LDLR and attenuated LDLR activity in fibroblasts (Hobbs HH et al. Hum Mutat. 1992;1:445-66; Webb JC et al. J Lipid Res. 1996;37:368-81; Blackett PR, Am. J. Med. Genet. 1995 Nov;59(3):300-3). This variant was reported to segregate with FH in the mother and maternal grandmother of one proband (Webb JC et al. J Lipid Res. 1996;37:368-81). In addition, this variant has been identified in cohorts of FH patients from various ethnic groups and additional individuals with LDL-C levels consistent with FH (Hattori H et al. Hum Mutat. 1999;14:87; Fouchier SW et al. Hum Mutat. 2005;26:550-6; Ambry internal data). This alteration impacts residues in the conserved cluster of acidic amino acids at the C-terminal end of LDLR class A repeat 5 (Jeon H and Blacklow C. Annu. Rev. Biochem. 2005;74:535-62). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
|
|
|
Likely pathogenic
(Nov 19, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV004034458.3
First in ClinVar: Sep 16, 2023 Last updated: Nov 30, 2024 |
Comment:
In-frame insertion of 7 amino acids in a non-repeat region; Also known as FH Tulsa-1 and p.D200_D206dup due to alternate nomenclature; Not observed at significant … (more)
In-frame insertion of 7 amino acids in a non-repeat region; Also known as FH Tulsa-1 and p.D200_D206dup due to alternate nomenclature; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 15241806, 1301956, 8599353, 16250003, 17094996, 10447263, 30583242, 34906454, 9026534) (less)
|
|
|
Likely pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, familial, 1
Affected status: yes
Allele origin:
germline
|
Juno Genomics, Hangzhou Juno Genomics, Inc
Accession: SCV005416897.1
First in ClinVar: Nov 30, 2024 Last updated: Nov 30, 2024 |
Comment:
PM2_Supporting+PM4+PS4_Supporting+PP4+PS3_Moderate
|
|
|
Pathogenic
(-)
|
no assertion criteria provided
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum
Accession: SCV000606184.1
First in ClinVar: Sep 30, 2017 Last updated: Sep 30, 2017 |
|
Comment:
Comment:
This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial hypercholesterolemia and homozygous familial hypercholesterolemia (PMID: 1301956, 8599353, 9026534, 10447263, 16250003; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic.
Comment:
The c.663_683dup21 pathogenic mutation (also known as p.D221_D227dup), located in coding exon 4 of the LDLR gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 663 to 683. This results in the duplication of seven residues (DCKDKSD) between amino acids 221 and 227. This variant, also known as FH Tulsa-1, has been detected in individuals with homozygous familial hypercholesterolemia (FH), who had a second variant in LDLR and attenuated LDLR activity in fibroblasts (Hobbs HH et al. Hum Mutat. 1992;1:445-66; Webb JC et al. J Lipid Res. 1996;37:368-81; Blackett PR, Am. J. Med. Genet. 1995 Nov;59(3):300-3). This variant was reported to segregate with FH in the mother and maternal grandmother of one proband (Webb JC et al. J Lipid Res. 1996;37:368-81). In addition, this variant has been identified in cohorts of FH patients from various ethnic groups and additional individuals with LDL-C levels consistent with FH (Hattori H et al. Hum Mutat. 1999;14:87; Fouchier SW et al. Hum Mutat. 2005;26:550-6; Ambry internal data). This alteration impacts residues in the conserved cluster of acidic amino acids at the C-terminal end of LDLR class A repeat 5 (Jeon H and Blacklow C. Annu. Rev. Biochem. 2005;74:535-62). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.
Comment:
In-frame insertion of 7 amino acids in a non-repeat region; Also known as FH Tulsa-1 and p.D200_D206dup due to alternate nomenclature; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 15241806, 1301956, 8599353, 16250003, 17094996, 10447263, 30583242, 34906454, 9026534)
Comment:
PM2_Supporting+PM4+PS4_Supporting+PP4+PS3_Moderate
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic.
Comment:
This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial hypercholesterolemia and homozygous familial hypercholesterolemia (PMID: 1301956, 8599353, 9026534, 10447263, 16250003; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic.
Comment:
The c.663_683dup21 pathogenic mutation (also known as p.D221_D227dup), located in coding exon 4 of the LDLR gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 663 to 683. This results in the duplication of seven residues (DCKDKSD) between amino acids 221 and 227. This variant, also known as FH Tulsa-1, has been detected in individuals with homozygous familial hypercholesterolemia (FH), who had a second variant in LDLR and attenuated LDLR activity in fibroblasts (Hobbs HH et al. Hum Mutat. 1992;1:445-66; Webb JC et al. J Lipid Res. 1996;37:368-81; Blackett PR, Am. J. Med. Genet. 1995 Nov;59(3):300-3). This variant was reported to segregate with FH in the mother and maternal grandmother of one proband (Webb JC et al. J Lipid Res. 1996;37:368-81). In addition, this variant has been identified in cohorts of FH patients from various ethnic groups and additional individuals with LDL-C levels consistent with FH (Hattori H et al. Hum Mutat. 1999;14:87; Fouchier SW et al. Hum Mutat. 2005;26:550-6; Ambry internal data). This alteration impacts residues in the conserved cluster of acidic amino acids at the C-terminal end of LDLR class A repeat 5 (Jeon H and Blacklow C. Annu. Rev. Biochem. 2005;74:535-62). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.
Comment:
In-frame insertion of 7 amino acids in a non-repeat region; Also known as FH Tulsa-1 and p.D200_D206dup due to alternate nomenclature; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 15241806, 1301956, 8599353, 16250003, 17094996, 10447263, 30583242, 34906454, 9026534)
Comment:
PM2_Supporting+PM4+PS4_Supporting+PP4+PS3_Moderate
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. | Tosi I | Atherosclerosis | 2007 | PMID: 17094996 |
| Update of the molecular basis of familial hypercholesterolemia in The Netherlands. | Fouchier SW | Human mutation | 2005 | PMID: 16250003 |
| Identification of recurrent and novel mutations in the LDL receptor gene in Japanese familial hypercholesterolemia. Mutation in brief no. 248. Online. | Hattori H | Human mutation | 1999 | PMID: 10447263 |
| Characterization of mutations in the low density lipoprotein (LDL)-receptor gene in patients with homozygous familial hypercholesterolemia, and frequency of these mutations in FH patients in the United Kingdom. | Webb JC | Journal of lipid research | 1996 | PMID: 9026534 |
| FH Tulsa-1 and -2: two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male. | Blackett PR | American journal of medical genetics | 1995 | PMID: 8599353 |
| Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. | Hobbs HH | Human mutation | 1992 | PMID: 1301956 |
Text-mined citations for rs879254620 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Jan 13, 2025
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.