ClinVar Genomic variation as it relates to human health
NM_020975.6(RET):c.57_65dup (p.Leu22_Gly23insProLeuLeu)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_020975.6(RET):c.57_65dup (p.Leu22_Gly23insProLeuLeu)
Variation ID: 241364 Accession: VCV000241364.11
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 10q11.21 10: 43077308-43077309 (GRCh38) [ NCBI UCSC ] 10: 43572756-43572757 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 10, 2018 May 1, 2024 Apr 4, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_020975.6:c.57_65dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_066124.1:p.Leu22_Gly23insProLeuLeu inframe insertion NM_000323.2:c.57_65dup NP_000314.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406743.1:c.57_65dup NP_001393672.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406744.1:c.57_65dup NP_001393673.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406759.1:c.57_65dup NP_001393688.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406760.1:c.57_65dup NP_001393689.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406761.1:c.57_65dup NP_001393690.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406762.1:c.57_65dup NP_001393691.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406763.1:c.57_65dup NP_001393692.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406764.1:c.57_65dup NP_001393693.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406765.1:c.57_65dup NP_001393694.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406766.1:c.57_65dup NP_001393695.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406767.1:c.57_65dup NP_001393696.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406768.1:c.57_65dup NP_001393697.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406769.1:c.57_65dup NP_001393698.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406770.1:c.57_65dup NP_001393699.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406771.1:c.57_65dup NP_001393700.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406772.1:c.57_65dup NP_001393701.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406773.1:c.57_65dup NP_001393702.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406774.1:c.57_65dup NP_001393703.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406775.1:c.57_65dup NP_001393704.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406776.1:c.57_65dup NP_001393705.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406777.1:c.57_65dup NP_001393706.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406778.1:c.57_65dup NP_001393707.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406779.1:c.57_65dup NP_001393708.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406780.1:c.57_65dup NP_001393709.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406781.1:c.57_65dup NP_001393710.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406782.1:c.57_65dup NP_001393711.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406783.1:c.57_65dup NP_001393712.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406784.1:c.57_65dup NP_001393713.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406785.1:c.57_65dup NP_001393714.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406786.1:c.57_65dup NP_001393715.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406787.1:c.57_65dup NP_001393716.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406788.1:c.57_65dup NP_001393717.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406789.1:c.57_65dup NP_001393718.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406790.1:c.57_65dup NP_001393719.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406791.1:c.57_65dup NP_001393720.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406792.1:c.57_65dup NP_001393721.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406793.1:c.57_65dup NP_001393722.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_001406794.1:c.57_65dup NP_001393723.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_020629.2:c.57_65dup NP_065680.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_020630.7:c.57_65dup NP_065681.1:p.Leu22_Gly23insProLeuLeu inframe indel NM_020975.4:c.57_65dupGCCGCTGCT inframe indel NC_000010.11:g.43077315_43077323dup NC_000010.10:g.43572763_43572771dup NG_007489.1:g.5247_5255dup NG_045003.1:g.4502_4510dup LRG_518:g.5247_5255dup LRG_518t1:c.57_65dup LRG_518p1:p.Leu22_Gly23insProLeuLeu LRG_518t2:c.57_65dup LRG_518p2:p.Leu22_Gly23insProLeuLeu - Protein change
- Other names
- -
- Canonical SPDI
- NC_000010.11:43077308:GCTGCTGCCGCTGCT:GCTGCTGCCGCTGCTGCCGCTGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
RET | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
3580 | 3702 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Uncertain significance (1) |
criteria provided, single submitter
|
May 9, 2022 | RCV000225980.12 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Apr 4, 2023 | RCV002347912.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(May 09, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000290565.9
First in ClinVar: Jul 01, 2016 Last updated: Feb 07, 2023 |
Comment:
This variant, c.57_65dup, results in the insertion of 3 amino acid(s) of the RET protein (p.Pro20_Leu22dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.57_65dup, results in the insertion of 3 amino acid(s) of the RET protein (p.Pro20_Leu22dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 241364). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
|
|
Uncertain significance
(Apr 04, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002650571.3
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.57_65dupGCCGCTGCT variant (also known as p.P20_L22dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of GCCGCTGCT at nucleotide … (more)
The c.57_65dupGCCGCTGCT variant (also known as p.P20_L22dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of GCCGCTGCT at nucleotide positions 57 to 65. This results in the duplication of 3 extra residues (PLL) between codons 20 and 22. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs878855065 ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.