ClinVar Genomic variation as it relates to human health
NM_000070.2(CAPN3):c.643_663del(p.Ser215_Gly221del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000070.2(CAPN3):c.643_663del(p.Ser215_Gly221del)
Variation ID: 217159 Accession: VCV000217159.25
- Type and length
-
Deletion, 21 bp
- Location
-
Cytogenetic: 15q15.1 15: 42388935-42388955 (GRCh38) [ NCBI UCSC ] 15: 42681133-42681153 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 19, 2017 Feb 28, 2024 Oct 30, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000070.3:c.643_663del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000061.1:p.Ser215_Gly221del inframe deletion NM_024344.2:c.643_663del NP_077320.1:p.Ser215_Gly221del inframe deletion NM_173087.2:c.643_663del NP_775110.1:p.Ser215_Gly221del inframe deletion NC_000015.10:g.42388938_42388958del NC_000015.9:g.42681136_42681156del NG_008660.1:g.45836_45856del LRG_849:g.45836_45856del LRG_849t1:c.643_663del LRG_849p1:p.Ser215_Gly221del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000015.10:42388934:GGTTCCTACGAAGCTCTGAAAGGT:GGT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
CAPN3 | - | - |
GRCh38 GRCh37 |
1700 | 1839 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (4) |
criteria provided, single submitter
|
Oct 30, 2023 | RCV000201156.17 | |
Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Jul 26, 2022 | RCV000379696.16 | |
Pathogenic (2) |
criteria provided, single submitter
|
Aug 27, 2023 | RCV000681607.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(May 27, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Athena Diagnostics
Accession: SCV000255670.3
First in ClinVar: Oct 19, 2015 Last updated: Dec 19, 2017 |
|
|
Pathogenic
(Mar 30, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000331951.4
First in ClinVar: Dec 06, 2016 Last updated: Dec 15, 2018 |
Number of individuals with the variant: 25
Sex: mixed
|
|
Pathogenic
(Apr 29, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not provided
Affected status: unknown
Allele origin:
germline
|
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV001716211.1
First in ClinVar: Jun 15, 2021 Last updated: Jun 15, 2021 |
Comment:
PS3, PS4_moderate, PM2, PM4, PP1
Number of individuals with the variant: 1
|
|
Pathogenic
(Jul 26, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000330275.7
First in ClinVar: Dec 06, 2016 Last updated: Mar 04, 2023 |
Comment:
Previously identified in the heterozygous state, without a second variant, in multiple individuals with variable features including muscle weakness/atrophy, hyperCKemia, myalgia, back pain, and reduced … (more)
Previously identified in the heterozygous state, without a second variant, in multiple individuals with variable features including muscle weakness/atrophy, hyperCKemia, myalgia, back pain, and reduced calpain protein on western blot analysis and muscle biopsy; however, comprehensive testing, including deletion/duplication analysis, was not completed for all patients and inheritance from an unaffected parent was noted (Duno et al., 2008; Vissing et al., 2016; Martinez-Thompson et al., 2017); In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect; In-frame deletion of 7 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 19556129, 18055493, 10330340, 22443334, 9150160, 18337726, 27259757, 28881388) (less)
|
|
Pathogenic
(Aug 27, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Muscular dystrophy, limb-girdle, autosomal dominant 4
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004211575.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(May 03, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV002018086.3
First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024 |
|
|
Pathogenic
(Oct 30, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Autosomal recessive limb-girdle muscular dystrophy type 2A
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000645511.9
First in ClinVar: Dec 26, 2017 Last updated: Feb 28, 2024 |
Comment:
This variant, c.643_663del, results in the deletion of 7 amino acid(s) of the CAPN3 protein (p.Ser215_Gly221del), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.643_663del, results in the deletion of 7 amino acid(s) of the CAPN3 protein (p.Ser215_Gly221del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs772579407, gnomAD 0.004%). This variant has been observed in individuals with autosomal dominant and autosomal recessive limb-girdle muscular dystrophy (PMID: 18337726, 27259757, 28881388; Invitae). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 217159). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Sep 26, 2018)
|
no assertion criteria provided
Method: literature only
|
MUSCULAR DYSTROPHY, LIMB-GIRDLE, AUTOSOMAL DOMINANT 4
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000809046.1
First in ClinVar: Sep 30, 2018 Last updated: Sep 30, 2018 |
Comment on evidence:
In 36 patients from 10 families of northern European descent with autosomal dominant limb-girdle muscular dystrophy type 1I (LGMDD4; 618129), Vissing et al. (2016) identified … (more)
In 36 patients from 10 families of northern European descent with autosomal dominant limb-girdle muscular dystrophy type 1I (LGMDD4; 618129), Vissing et al. (2016) identified a heterozygous in-frame 21-bp deletion (c.643_663del21, NM_000070) in the CAPN3 gene. The variant is present at an allele frequency of 0.006% among individuals of European descent in the ExAC database. Haplotype analysis of 4 families indicated a founder effect. Analysis of several patients' muscle tissue showed normal mRNA levels and no evidence of nonsense-mediated mRNA decay, but significantly decreased CAPN3 protein levels, at less than 15% of control values. Vissing et al. (2016) postulated that the in-frame nature of the mutation may have led to expression of a mutated protein that could have a dominant-negative effect. In 3 unrelated patients of northern European descent with LGMDD4, Martinez-Thompson et al. (2018) identified the same heterozygous 21-bp deletion in the CAPN3 gene that had been reported by Vissing et al. (2016). The deletion resulted in the deletion of residues Ser215_Gly221 in the first structural domain. The mutations were found by next-generation, whole-exome, or Sanger sequencing; all were confirmed by Sanger sequencing. Each proband had a family history of the disorder, although not all affected family members were available for genetic testing. Functional studies of the variant were not performed, but Western blot analysis of patient tissues showed greatly decreased amounts of the CAPN3 protein. (less)
|
|
Likely pathogenic
(Sep 28, 2017)
|
no assertion criteria provided
Method: clinical testing
|
Autosomal recessive limb-girdle muscular dystrophy type 2A
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000794393.2
First in ClinVar: Aug 04, 2018 Last updated: Dec 23, 2019 |
|
|
Pathogenic
(Jan 21, 2021)
|
no assertion criteria provided
Method: clinical testing
|
Limb-girdle muscular dystrophy type 2A
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002094454.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
Autosomal recessive limb-girdle muscular dystrophy type 2A
Affected status: unknown
Allele origin:
germline
|
GeneReviews
Accession: SCV002015209.2
First in ClinVar: Nov 20, 2021 Last updated: Oct 01, 2022 |
Comment:
A single heterozygous in-frame c.643_663del21 pathogenic variant in CAPN3 results in a dominantly inherited form of calpainopathy [Vissing et al 2016]. Of note, this variant … (more)
A single heterozygous in-frame c.643_663del21 pathogenic variant in CAPN3 results in a dominantly inherited form of calpainopathy [Vissing et al 2016]. Of note, this variant has been identified in compound heterozygosity with other pathogenic variants in CAPN3, including c.2362_2363delinsTCATCT, c.550delA, p.Ala45Thr, and p.Asp419Gly [Richard et al 1997, Groen et al 2007, Saenz & Lopez de Munain 2017]. Pathogenic variant most likely the result of a founder effect followed by genetic isolation in populations in Northern European countries including UK, Norway, Sweden, Denmark [Vissing et al 2016] (less)
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Autosomal dominant calpainopathy due to heterozygous CAPN3 C.643_663del21. | Martinez-Thompson JM | Muscle & nerve | 2018 | PMID: 28881388 |
Calpainopathy with macrophage-rich, regional inflammatory infiltrates. | Schutz PW | Neuromuscular disorders : NMD | 2017 | PMID: 28602176 |
Dominant LGMD2A: alternative diagnosis or hidden digenism? | Sáenz A | Brain : a journal of neurology | 2017 | PMID: 27818383 |
A heterozygous 21-bp deletion in CAPN3 causes dominantly inherited limb girdle muscular dystrophy. | Vissing J | Brain : a journal of neurology | 2016 | PMID: 27259757 |
Calpain 3 is important for muscle regeneration: evidence from patients with limb girdle muscular dystrophies. | Hauerslev S | BMC musculoskeletal disorders | 2012 | PMID: 22443334 |
Immunohistochemical analysis of calpain 3: advantages and limitations in diagnosing LGMD2A. | Charlton R | Neuromuscular disorders : NMD | 2009 | PMID: 19556129 |
cDNA analyses of CAPN3 enhance mutation detection and reveal a low prevalence of LGMD2A patients in Denmark. | Duno M | European journal of human genetics : EJHG | 2008 | PMID: 18337726 |
Analysis of the UK diagnostic strategy for limb girdle muscular dystrophy 2A. | Groen EJ | Brain : a journal of neurology | 2007 | PMID: 18055493 |
Calpainopathy-a survey of mutations and polymorphisms. | Richard I | American journal of human genetics | 1999 | PMID: 10330340 |
Multiple independent molecular etiology for limb-girdle muscular dystrophy type 2A patients from various geographical origins. | Richard I | American journal of human genetics | 1997 | PMID: 9150160 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CAPN3 | - | - | - | - |
click to load more click to collapse |
Text-mined citations for rs863224965 ...
HelpRecord last updated May 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.