For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with MUTYH-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Thr467Argfs*4) in the MUTYH gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MUTYH are known to be pathogenic (PMID: 18534194, 20663686).
ClinVar Genomic variation as it relates to human health
NM_001048174.2(MUTYH):c.1305_1315dup (p.Thr439delinsArgProGlnTer)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001048174.2(MUTYH):c.1305_1315dup (p.Thr439delinsArgProGlnTer)
Variation ID: 2117487 Accession: VCV002117487.2
- Type and length
-
Duplication, 11 bp
- Location
-
Cytogenetic: 1p34.1 1: 45331258-45331259 (GRCh38) [ NCBI UCSC ] 1: 45796930-45796931 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 8, 2023 Feb 20, 2024 Mar 26, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001048174.2:c.1305_1315dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001041639.1:p.Thr439delinsArgProGlnTer nonsense NM_001128425.2:c.1389_1399dup MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001121897.1:p.Thr467delinsArgProGlnTer nonsense NM_001048171.2:c.1305_1315dup NP_001041636.2:p.Thr439delinsArgProGlnTer nonsense NM_001048172.2:c.1308_1318dup NP_001041637.1:p.Thr440delinsArgProGlnTer nonsense NM_001048173.2:c.1305_1315dup NP_001041638.1:p.Thr439delinsArgProGlnTer nonsense NM_001293190.2:c.1350_1360dup NP_001280119.1:p.Thr454delinsArgProGlnTer nonsense NM_001293191.2:c.1338_1348dup NP_001280120.1:p.Thr450delinsArgProGlnTer nonsense NM_001293192.2:c.1029_1039dup NP_001280121.1:p.Thr347delinsArgProGlnTer nonsense NM_001293195.2:c.1305_1315dup NP_001280124.1:p.Thr439delinsArgProGlnTer nonsense NM_001293196.2:c.1029_1039dup NP_001280125.1:p.Thr347delinsArgProGlnTer nonsense NM_001350650.2:c.960_970dup NP_001337579.1:p.Thr324delinsArgProGlnTer nonsense NM_001350651.2:c.960_970dup NP_001337580.1:p.Thr324delinsArgProGlnTer nonsense NM_001407069.1:c.1337_1347dup NP_001393998.1:p.Thr450Argfs frameshift NM_001407070.1:c.1304_1314dup NP_001393999.1:p.Thr439Argfs frameshift NM_001407071.1:c.1307_1317dup NP_001394000.1:p.Thr440Argfs frameshift NM_001407072.1:c.1304_1314dup NP_001394001.1:p.Thr439Argfs frameshift NM_001407073.1:c.1304_1314dup NP_001394002.1:p.Thr439Argfs frameshift NM_001407075.1:c.1220_1230dup NP_001394004.1:p.Thr411Argfs frameshift NM_001407077.1:c.1337_1347dup NP_001394006.1:p.Thr450Argfs frameshift NM_001407078.1:c.1307_1317dup NP_001394007.1:p.Thr440Argfs frameshift NM_001407079.1:c.1265_1275dup NP_001394008.1:p.Thr426Argfs frameshift NM_001407080.1:c.1262_1272dup NP_001394009.1:p.Thr425Argfs frameshift NM_001407081.1:c.1304_1314dup NP_001394010.1:p.Thr439Argfs frameshift NM_001407082.1:c.959_969dup NP_001394011.1:p.Thr324Argfs frameshift NM_001407083.1:c.1346_1356dup NP_001394012.1:p.Thr453Argfs frameshift NM_001407085.1:c.1346_1356dup NP_001394014.1:p.Thr453Argfs frameshift NM_001407086.1:c.1307_1317dup NP_001394015.1:p.Thr440Argfs frameshift NM_001407087.1:c.1325_1335dup NP_001394016.1:p.Thr446Argfs frameshift NM_001407088.1:c.1304_1314dup NP_001394017.1:p.Thr439Argfs frameshift NM_001407089.1:c.1304_1314dup NP_001394018.1:p.Thr439Argfs frameshift NM_001407091.1:c.1028_1038dup NP_001394020.1:p.Thr347Argfs frameshift NM_012222.3:c.1380_1390dup NP_036354.1:p.Thr464delinsArgProGlnTer nonsense NR_146882.2:n.1533_1543dup non-coding transcript variant NR_146883.2:n.1382_1392dup non-coding transcript variant NR_176269.1:n.1528_1538dup NR_176270.1:n.1468_1478dup NR_176271.1:n.1391_1401dup NR_176272.1:n.1455_1465dup NR_176273.1:n.1413_1423dup NR_176274.1:n.1468_1478dup NC_000001.11:g.45331260_45331270dup NC_000001.10:g.45796932_45796942dup NG_008189.1:g.14202_14212dup LRG_220:g.14202_14212dup LRG_220t1:c.1388_1398dup LRG_220p1:p.Thr467Argfs - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000001.11:45331258:TCACTGGGGTCT:TCACTGGGGTCTCACTGGGGTCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MUTYH | - | - |
GRCh38 GRCh37 |
2688 | 2844 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
criteria provided, single submitter
|
Mar 26, 2022 | RCV003039224.3 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Mar 26, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Familial adenomatous polyposis 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003333430.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with MUTYH-related conditions. … (more)
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with MUTYH-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Thr467Argfs*4) in the MUTYH gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MUTYH are known to be pathogenic (PMID: 18534194, 20663686). (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with MUTYH-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Thr467Argfs*4) in the MUTYH gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MUTYH are known to be pathogenic (PMID: 18534194, 20663686).
Citations for germline classification of this variant
HelpText-mined citations for this variant ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.