VCV002040243.2 - ClinVar

NM_001379500.1(COL18A1):c.2960_2987del (p.Pro987fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001379500.1(COL18A1):c.2960_2987del (p.Pro987fs)

Variation ID: 2040243 Accession: VCV002040243.2

Type and length

Deletion, 28 bp

Location

Cytogenetic: 21q22.3 21: 45505224-45505251 (GRCh38) [ NCBI UCSC ] 21: 46925138-46925165 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 8, 2023	Feb 20, 2024	May 8, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_001379500.1:c.2960_2987del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001366429.1:p.Pro987fs	frameshift
NM_030582.4:c.3491_3518del	NP_085059.2:p.Pro1164fs	frameshift
NM_130444.3:c.4196_4223del	NP_569711.2:p.Pro1399fs	frameshift
NC_000021.9:g.45505225_45505252del
NC_000021.8:g.46925139_46925166del
NG_011903.1:g.105034_105061del
NG_028278.2:g.62893_62920del

... more HGVS ... less HGVS

Protein change

P1164fs, P1399fs, P987fs

Other names

Canonical SPDI

NC_000021.9:45505223:CCCGGCCCCCCAGGCCCCCCAGGGCCCCC:C

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
COL18A1		-	-	GRCh38 GRCh38 GRCh37	1841	3025
SLC19A1		-	-	GRCh38 GRCh38 GRCh37	156	1240

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (1)	criteria provided, single submitter	May 8, 2023	RCV002886327.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (May 08, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV003246966.2 First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024	Publications: PubMed (2) PubMed: 12415512‚ 25456301 Comment: For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 2040243). This variant has not been … (more) For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 2040243). This variant has not been reported in the literature in individuals affected with COL18A1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro984Leufs*35) in the COL18A1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in COL18A1 are known to be pathogenic (PMID: 12415512, 25456301). (less)

Comment:

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 2040243). This variant has not been reported in the literature in individuals affected with COL18A1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro984Leufs*35) in the COL18A1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in COL18A1 are known to be pathogenic (PMID: 12415512, 25456301).

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Brain malformations associated with Knobloch syndrome--review of literature, expanding clinical spectrum, and identification of novel mutations.	Caglayan AO	Pediatric neurology	2014	PMID: 25456301
Molecular analysis of collagen XVIII reveals novel mutations, presence of a third isoform, and possible genetic heterogeneity in Knobloch syndrome.	Suzuki OT	American journal of human genetics	2002	PMID: 12415512

Text-mined citations for this variant ...

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_001379500.1(COL18A1):c.2960_2987del (p.Pro987fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...