In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.His1351Metfs*9) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 10 amino acid(s) of the MSH6 protein.
ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.4036_4049dup (p.His1351fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.4036_4049dup (p.His1351fs)
Variation ID: 2023630 Accession: VCV002023630.2
- Type and length
-
Duplication, 14 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806812-47806813 (GRCh38) [ NCBI UCSC ] 2: 48033951-48033952 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 8, 2023 Feb 20, 2024 Aug 12, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.4036_4049dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.His1351fs frameshift NM_001281492.2:c.3646_3659dup NP_001268421.1:p.His1221fs frameshift NM_001281493.2:c.3130_3143dup NP_001268422.1:p.His1049fs frameshift NM_001281494.2:c.3130_3143dup NP_001268423.1:p.His1049fs frameshift NM_001406795.1:c.4132_4145dup NP_001393724.1:p.His1383Metfs frameshift NM_001406796.1:c.4036_4049dup NP_001393725.1:p.His1351Metfs frameshift NM_001406797.1:c.3739_3752dup NP_001393726.1:p.His1252Metfs frameshift NM_001406798.1:c.3862_3875dup NP_001393727.1:p.His1293Metfs frameshift NM_001406799.1:c.3511_3524dup NP_001393728.1:p.His1176Metfs frameshift NM_001406800.1:c.*57_*70dup NM_001406801.1:c.*17_*30dup NM_001406802.1:c.*17_*30dup NM_001406803.1:c.3172_3185dup NP_001393732.1:p.His1063Metfs frameshift NM_001406804.1:c.3958_3971dup NP_001393733.1:p.His1325Metfs frameshift NM_001406805.1:c.3739_3752dup NP_001393734.1:p.His1252Metfs frameshift NM_001406806.1:c.3511_3524dup NP_001393735.1:p.His1176Metfs frameshift NM_001406807.1:c.3511_3524dup NP_001393736.1:p.His1176Metfs frameshift NM_001406808.1:c.*17_*30dup NM_001406809.1:c.4036_4049dup NP_001393738.1:p.His1351Metfs frameshift NM_001406811.1:c.3130_3143dup NP_001393740.1:p.His1049Metfs frameshift NM_001406812.1:c.3130_3143dup NP_001393741.1:p.His1049Metfs frameshift NM_001406813.1:c.4042_4055dup NP_001393742.1:p.His1353Metfs frameshift NM_001406814.1:c.3130_3143dup NP_001393743.1:p.His1049Metfs frameshift NM_001406815.1:c.3130_3143dup NP_001393744.1:p.His1049Metfs frameshift NM_001406816.1:c.3130_3143dup NP_001393745.1:p.His1049Metfs frameshift NM_001406817.1:c.2470_2483dup NP_001393746.1:p.His829Metfs frameshift NM_001406818.1:c.3739_3752dup NP_001393747.1:p.His1252Metfs frameshift NM_001406819.1:c.3739_3752dup NP_001393748.1:p.His1252Metfs frameshift NM_001406820.1:c.3739_3752dup NP_001393749.1:p.His1252Metfs frameshift NM_001406821.1:c.3739_3752dup NP_001393750.1:p.His1252Metfs frameshift NM_001406822.1:c.*17_*30dup NM_001406823.1:c.3130_3143dup NP_001393752.1:p.His1049Metfs frameshift NM_001406824.1:c.3739_3752dup NP_001393753.1:p.His1252Metfs frameshift NM_001406825.1:c.3739_3752dup NP_001393754.1:p.His1252Metfs frameshift NM_001406826.1:c.3868_3881dup NP_001393755.1:p.His1295Metfs frameshift NM_001406827.1:c.3739_3752dup NP_001393756.1:p.His1252Metfs frameshift NM_001406828.1:c.3739_3752dup NP_001393757.1:p.His1252Metfs frameshift NM_001406829.1:c.3130_3143dup NP_001393758.1:p.His1049Metfs frameshift NM_001406830.1:c.3739_3752dup NP_001393759.1:p.His1252Metfs frameshift NM_001406831.1:c.817_830dup NP_001393760.1:p.His278Metfs frameshift NM_001406832.1:c.883_896dup NP_001393761.1:p.His300Metfs frameshift NM_001407362.1:c.1981_1994dup NP_001394291.1:p.His666Metfs frameshift NR_176256.1:n.2966_2979dup NR_176257.1:n.4297_4310dup NR_176258.1:n.4226_4239dup NR_176259.1:n.4125_4138dup NR_176260.1:n.2070_2083dup NR_176261.1:n.4007_4020dup NC_000002.12:g.47806813_47806826dup NC_000002.11:g.48033952_48033965dup NG_007111.1:g.28667_28680dup NG_008397.1:g.103850_103863dup LRG_219:g.28667_28680dup LRG_219t1:c.4036_4049dup LRG_219p1:p.His1351Metfs - Protein change
- H1221fs, H1049fs, H1351fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806812:GATGCTGAAGCTGT:GATGCTGAAGCTGTGATGCTGAAGCTGT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9161 | 9479 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
Aug 12, 2022 | RCV002858094.3 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(Aug 12, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary nonpolyposis colorectal neoplasms
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003228899.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024 |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more)
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.His1351Metfs*9) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 10 amino acid(s) of the MSH6 protein. (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.His1351Metfs*9) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 10 amino acid(s) of the MSH6 protein.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.