VCV002022821.2 - ClinVar

NM_001171.6(ABCC6):c.3913_3931dup (p.Gly1311fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001171.6(ABCC6):c.3913_3931dup (p.Gly1311fs)

Variation ID: 2022821 Accession: VCV002022821.2

Type and length

Duplication, 19 bp

Location

Cytogenetic: 16p13.11 16: 16154982-16154983 (GRCh38) [ NCBI UCSC ] 16: 16248839-16248840 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 8, 2023	Feb 20, 2024	Aug 8, 2022

HGVS

Nucleotide	Protein	Molecular consequence
NM_001171.6:c.3913_3931dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001162.5:p.Gly1311fs	frameshift
NM_001351800.1:c.3571_3589dup	NP_001338729.1:p.Gly1197fs	frameshift
NR_147784.1:n.3575_3593dup		non-coding transcript variant
NC_000016.10:g.16154984_16155002dup
NC_000016.9:g.16248841_16248859dup
NG_007558.3:g.73617_73635dup
LRG_1115:g.73617_73635dup
LRG_1115t1:c.3913_3931dup	LRG_1115p1:p.Gly1311fs

... more HGVS ... less HGVS

Protein change

G1311fs, G1197fs

Other names

Canonical SPDI

NC_000016.10:16154982:CACTGGCCAGGGAGGACTTC:CACTGGCCAGGGAGGACTTCACTGGCCAGGGAGGACTTC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ABCC6		-	-	GRCh38 GRCh38 GRCh37	1470	1833

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (1)	criteria provided, single submitter	Aug 8, 2022	RCV002852774.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Aug 08, 2022)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV003228071.2 First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024	Publications: PubMed (2) PubMed: 11536079‚ 17617515 Comment: For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with ABCC6-related conditions. … (more) For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with ABCC6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly1311Glufs*16) in the ABCC6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ABCC6 are known to be pathogenic (PMID: 11536079, 17617515). (less)

Comment:

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with ABCC6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly1311Glufs*16) in the ABCC6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ABCC6 are known to be pathogenic (PMID: 11536079, 17617515).

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Mutation detection in the ABCC6 gene and genotype-phenotype analysis in a large international case series affected by pseudoxanthoma elasticum.	Pfendner EG	Journal of medical genetics	2007	PMID: 17617515
A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum.	Le Saux O	American journal of human genetics	2001	PMID: 11536079

Text-mined citations for this variant ...

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_001171.6(ABCC6):c.3913_3931dup (p.Gly1311fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...