ClinVar Genomic variation as it relates to human health
NM_000251.3(MSH2):c.1103_1138del (p.Glu368_Leu380delinsVal)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000251.3(MSH2):c.1103_1138del (p.Glu368_Leu380delinsVal)
Variation ID: 1792897 Accession: VCV001792897.2
- Type and length
-
Deletion, 36 bp
- Location
-
Cytogenetic: 2p21 2: 47429768-47429803 (GRCh38) [ NCBI UCSC ] 2: 47656907-47656942 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 Mar 8, 2019 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000251.3:c.1103_1138del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000242.1:p.Glu368_Leu380delinsVal inframe indel NM_001258281.1:c.905_940del NP_001245210.1:p.Glu302_Leu314delinsVal inframe indel NM_001406631.1:c.1103_1138del36 NP_001393560.1:p.Glu368_Leu380delinsVal inframe indel NM_001406632.1:c.1103_1138del36 NP_001393561.1:p.Glu368_Leu380delinsVal inframe indel NM_001406633.1:c.1103_1138del36 NP_001393562.1:p.Glu368_Leu380delinsVal inframe indel NM_001406634.1:c.1103_1138del36 NP_001393563.1:p.Glu368_Leu380delinsVal inframe indel NM_001406635.1:c.1103_1138del36 NP_001393564.1:p.Glu368_Leu380delinsVal inframe indel NM_001406636.1:c.1070_1105del36 NP_001393565.1:p.Glu357_Leu369delinsVal inframe indel NM_001406637.1:c.1103_1138del36 NP_001393566.1:p.Glu368_Leu380delinsVal inframe indel NM_001406638.1:c.1103_1138del36 NP_001393567.1:p.Glu368_Leu380delinsVal inframe indel NM_001406639.1:c.1103_1138del36 NP_001393568.1:p.Glu368_Leu380delinsVal inframe indel NM_001406640.1:c.1103_1138del36 NP_001393569.1:p.Glu368_Leu380delinsVal inframe indel NM_001406641.1:c.1103_1138del36 NP_001393570.1:p.Glu368_Leu380delinsVal inframe indel NM_001406642.1:c.1103_1138del36 NP_001393571.1:p.Glu368_Leu380delinsVal inframe indel NM_001406643.1:c.1103_1138del36 NP_001393572.1:p.Glu368_Leu380delinsVal inframe indel NM_001406644.1:c.1103_1138del36 NP_001393573.1:p.Glu368_Leu380delinsVal inframe indel NM_001406645.1:c.1103_1138del36 NP_001393574.1:p.Glu368_Leu380delinsVal inframe indel NM_001406646.1:c.1103_1138del36 NP_001393575.1:p.Glu368_Leu380delinsVal inframe indel NM_001406647.1:c.953_988del36 NP_001393576.1:p.Glu318_Leu330delinsVal inframe indel NM_001406648.1:c.1103_1138del36 NP_001393577.1:p.Glu368_Leu380delinsVal inframe indel NM_001406649.1:c.953_988del36 NP_001393578.1:p.Glu318_Leu330delinsVal inframe indel NM_001406650.1:c.953_988del36 NP_001393579.1:p.Glu318_Leu330delinsVal inframe indel NM_001406651.1:c.953_988del36 NP_001393580.1:p.Glu318_Leu330delinsVal inframe indel NM_001406652.1:c.953_988del36 NP_001393581.1:p.Glu318_Leu330delinsVal inframe indel NM_001406653.1:c.1043_1078del36 NP_001393582.1:p.Glu348_Leu360delinsVal inframe indel NM_001406654.1:c.683_718del36 NP_001393583.1:p.Glu228_Leu240delinsVal inframe indel NM_001406655.1:c.1103_1138del36 NP_001393584.1:p.Glu368_Leu380delinsVal inframe indel NM_001406656.1:c.206_241del36 NP_001393585.1:p.Glu69_Leu81delinsVal inframe indel NM_001406657.1:c.1103_1138del36 NP_001393586.1:p.Glu368_Leu380delinsVal inframe indel NM_001406658.1:c.-254_-219del36 NM_001406659.1:c.-254_-219del36 NM_001406660.1:c.-254_-219del36 NM_001406661.1:c.-254_-219del36 NM_001406662.1:c.-254_-219del36 NM_001406666.1:c.1103_1138del36 NP_001393595.1:p.Glu368_Leu380delinsVal inframe indel NM_001406669.1:c.-254_-219del36 NM_001406672.1:c.953_988del36 NP_001393601.1:p.Glu318_Leu330delinsVal inframe indel NM_001406674.1:c.1103_1138del36 NP_001393603.1:p.Glu368_Leu380delinsVal inframe indel NR_176230.1:n.1139_1174del36 NR_176231.1:n.1139_1174del36 NR_176232.1:n.1139_1174del36 NR_176233.1:n.981_1016del36 NR_176234.1:n.1139_1174del36 NR_176235.1:n.1139_1174del36 NR_176236.1:n.1139_1174del36 NR_176237.1:n.1139_1174del36 NR_176238.1:n.1139_1174del36 NR_176239.1:n.1139_1174del36 NR_176240.1:n.1139_1174del36 NR_176241.1:n.1139_1174del36 NR_176242.1:n.1139_1174del36 NR_176243.1:n.989_1024del36 NR_176244.1:n.1139_1174del36 NR_176245.1:n.1139_1174del36 NR_176246.1:n.1139_1174del36 NR_176247.1:n.1139_1174del36 NR_176248.1:n.1139_1174del36 NR_176249.1:n.1139_1174del36 NR_176250.1:n.989_1024del36 NC_000002.12:g.47429768_47429803del NC_000002.11:g.47656907_47656942del NG_007110.2:g.31645_31680del LRG_218:g.31645_31680del LRG_218t1:c.1103_1138del36 LRG_218p1:p.Glu368_Leu380delinsVal - Protein change
- Other names
- -
- Canonical SPDI
- NC_000002.12:47429767:AAGATGCAGAATTGAGGCAGACTTTACAAGAAGATT:
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
7401 | 7563 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely pathogenic (1) |
criteria provided, single submitter
|
Mar 8, 2019 | RCV002433273.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Mar 08, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002742509.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.1103_1138del36 variant (also known as p.E368_L380delinsV) is located in coding exon 7 of the MSH2 gene. This variant results from an in-frame deletion of … (more)
The c.1103_1138del36 variant (also known as p.E368_L380delinsV) is located in coding exon 7 of the MSH2 gene. This variant results from an in-frame deletion of 36 nucleotides at positions 1103 to 1138. This results in the deletion of 13 amino acids (EDAELRQTLQEDL) at codons 368 to 380 and the insertion of a valine residue. This alteration was identified in the germline along with a somatic pathogenic MSH2 mutation in an individual who developed tumors associated with Muir-Torre syndrome that displayed high microsatellite instability (MSI-H) and/or loss of MSH2 expression on immunohistochemistry (IHC) (Ambry internal data). Based on an internal structural analysis, this variant is near known pathogenic variants (Warren JJ et al. Mol. Cell, 2007 May;26:579-92). This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). The majority of the amino acid positions in this region are highly conserved through mammals, but not in all available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al., PLoS ONE 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Structure of the human MutSalpha DNA lesion recognition complex. | Warren JJ | Molecular cell | 2007 | PMID: 17531815 |
Text-mined citations for this variant ...
HelpRecord last updated May 01, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.