ClinVar Genomic variation as it relates to human health
NM_001370259.2(MEN1):c.249_266del (p.Ser84_Leu89del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Likely pathogenic(1); Uncertain significance(1)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001370259.2(MEN1):c.249_266del (p.Ser84_Leu89del)
Variation ID: 1792056 Accession: VCV001792056.3
- Type and length
-
Deletion, 18 bp
- Location
-
Cytogenetic: 11q13.1 11: 64809844-64809861 (GRCh38) [ NCBI UCSC ] 11: 64577316-64577333 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 Oct 17, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001370259.2:c.249_266del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001357188.2:p.Ser84_Leu89del inframe deletion NM_000244.4:c.249_266del NP_000235.3:p.Ser84_Leu89del inframe deletion NM_001370251.2:c.249_266del NP_001357180.2:p.Ser84_Leu89del inframe deletion NM_001370260.2:c.249_266del NP_001357189.2:p.Ser84_Leu89del inframe deletion NM_001370261.2:c.249_266del NP_001357190.2:p.Ser84_Leu89del inframe deletion NM_001370262.2:c.249_266del NP_001357191.2:p.Ser84_Leu89del inframe deletion NM_001370263.2:c.249_266del NP_001357192.2:p.Ser84_Leu89del inframe deletion NM_001407142.1:c.246_263del18 NP_001394071.1:p.Ser84_Leu89del inframe indel NM_001407143.1:c.246_263del18 NP_001394072.1:p.Ser84_Leu89del inframe indel NM_001407144.1:c.246_263del18 NP_001394073.1:p.Ser84_Leu89del inframe indel NM_001407145.1:c.246_263del18 NP_001394074.1:p.Ser84_Leu89del inframe indel NM_001407146.1:c.246_263del18 NP_001394075.1:p.Ser84_Leu89del inframe indel NM_001407147.1:c.246_263del18 NP_001394076.1:p.Ser84_Leu89del inframe indel NM_001407148.1:c.246_263del18 NP_001394077.1:p.Ser84_Leu89del inframe indel NM_001407149.1:c.246_263del18 NP_001394078.1:p.Ser84_Leu89del inframe indel NM_001407150.1:c.246_263del18 NP_001394079.1:p.Ser84_Leu89del inframe indel NM_001407151.1:c.246_263del18 NP_001394080.1:p.Ser84_Leu89del inframe indel NM_001407152.1:c.246_263del18 NP_001394081.1:p.Ser84_Leu89del inframe indel NM_130799.2:c.249_266del18 inframe indel NM_130799.3:c.249_266del NP_570711.2:p.Ser84_Leu89del inframe deletion NM_130800.3:c.249_266del NP_570712.2:p.Ser84_Leu89del inframe deletion NM_130801.3:c.249_266del NP_570713.2:p.Ser84_Leu89del inframe deletion NM_130802.3:c.249_266del NP_570714.2:p.Ser84_Leu89del inframe deletion NM_130803.3:c.249_266del NP_570715.2:p.Ser84_Leu89del inframe deletion NM_130804.3:c.249_266del NP_570716.2:p.Ser84_Leu89del inframe deletion NR_176284.1:n.295_312del18 NR_176285.1:n.307_324del18 NR_176286.1:n.295_312del18 NR_176287.1:n.553_570del18 NC_000011.10:g.64809847_64809864del NC_000011.9:g.64577319_64577336del NG_008929.1:g.6434_6451del LRG_509:g.6434_6451del LRG_509t1:c.246_263del18 LRG_509p1:p.Ser84_Leu89del LRG_509t2:c.246_263del18 LRG_509p2:p.Ser84_Leu89del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000011.10:64809843:AGGGCGGCGATGATAGACAGG:AGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MEN1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
2579 | 2600 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely pathogenic (1) |
criteria provided, single submitter
|
Oct 17, 2023 | RCV002430924.2 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Oct 10, 2023 | RCV003517436.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Oct 10, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 1
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV004330965.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
Comment:
This variant, c.249_266del, results in the deletion of 6 amino acid(s) of the MEN1 protein (p.Ser84_Leu89del), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.249_266del, results in the deletion of 6 amino acid(s) of the MEN1 protein (p.Ser84_Leu89del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MEN1-related conditions. ClinVar contains an entry for this variant (Variation ID: 1792056). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
|
|
Likely pathogenic
(Oct 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002741012.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.249_266del18 variant is located in coding exon 1 of the MEN1 gene. This variant results from an in-frame TCTATCATCGCCGCCCTC deletion at nucleotide positions 249 … (more)
The c.249_266del18 variant is located in coding exon 1 of the MEN1 gene. This variant results from an in-frame TCTATCATCGCCGCCCTC deletion at nucleotide positions 249 to 266 and the impacted region is critical for protein function (Ambry internal data). This alteration has been observed in at least one individual with a personal history that is consistent with MEN1-related disease (Ambry internal data). In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpText-mined citations for this variant ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.